Biography

A Disrupted Homologue of the Human CLN3 or Juvenile Neuronal Ceroid Lipofuscinosis Gene in Saccharomyces cerevisiae: A Model to Study Batten Disease

Description
1.In order to investigate the biological function of the human CLN3 gene that is defective in Batten disease, we created a yeast strain by PCR-targeted disruption of the yeast gene (YHC3), which is a homologue of the human CLN3 gene.
Categories
Published
of 10
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Cellular and Molecular Neurobiology, Vol. 19, No. 5, 1999 Rapid Communication A Disrupted Homologue of the Human  CLN3  orJuvenile Neuronal Ceroid Lipofuscinosis Gene in  Saccharomyces cerevisiae : A Model to StudyBatten Disease Wei-Xing Guo, 1,2 Cungui Mao, 2 Lina M. Obeid, 2 and Rose-Mary Boustany 1,3 Recei v ed January 10, 1999; accepted March 2, 1999 SUMMARY 1. In order to investigate the biological function of the human  CLN3  gene that isdefective in Batten disease, we created a yeast strain by PCR-targeted disruption of theyeast gene  (YHC3),  which is a homologue of the human  CLN3  gene.2. Thephenotypiccharacterizationrevealedthatthe  yhc3  mutantsaremoresensitiveto combined heat and alkaline stress than the wild-type strains as determined by inhibitionof cell proliferation.3. This suggests that the  yhc3  mutant is a good model to investigate the biologicalfunction of human  CLN3  gene in mammalian cells and to understand the pathophysiologyof juvenile Batten disease. KEYWORDS:  Battendisease;degenerativedisease;PCR-basedgenedisruption;  sacchar-omyces cere v isiae. INTRODUCTION Batten disease, the juvenile form of neuronal ceroid lipofuscinosis (JNCL) is anautosomal recessive, inherited neurodegenerative disease of childhood (Boustany et al.,  1988). Clinical hallmarks include progressive visual failure, seizures, psycho-motor deterioration, and premature death occurring in the mid to late twenties(Boustany and Kolodny, 1989; Boustany, 1992; Boustany and Filipek, 1993). The CLN3  gene responsible for JNCL encodes a 438-amino acid novel protein whosefunction remains unknown (The International Batten Disease Consortium, 1995).The exact cellular localization of the CLN3 protein is not known, but it does notappear to be a lysosomal protein. More than 80 %  of affected patients harbor a 1 Department of Pediatrics, Duke University Medical Center, Durham, North Carolina 27710. 2 Department of Medicine, Medical Universityof South Carolina, Charleston,South Carolina29425-2211. 3 To whom correspondence should be addressed at P.O. Box 2604, MSRB, Duke University MedicalCenter, Durham, North Carolina 27710. Fax: 1-919-681-8090. e-mail: boust001@mc.duke.edu 671 0272-4340/99/1000-0671$16.00/0  ©  1999 Plenum Publishing Corporation  672 Guo, Mao, Obeid, and Boustany 1.02-kb deletion in the gene, which results in loss of 100 amino acids at the carboxylend of the protein with the last 28 amino acids of the mutant protein being differentfrom those in the wild-type protein.We haverecently shown thatthe intactmamma-lian  CLN3  gene has antiapoptotic effects (Puranam  et al.,  1999), that  CLN3  genedefects result in ceramide accumulation in neural tissues, and that the  CLN3  genemodulates ceramide levels upstream (Puranam  et al.,  1999). Ceramide itself isknown to induce growth inhibition in  Saccharomyces cere v isiae (S. cere v isiae)  andis specifically involved in the heat stress response in  S. cere v isiae  (Jenkins  et al., 1997). Sequence analysis indicates that human  CLN3  is highly homologous withgenes from other eukaryotic species, such as dog (GenBank Accession No. L76281),mouse (Lee  et al.,  1996), and  S. cere v isiae  (Mitchison  et al.,  1997). In the case of   S.cere v isiae,  it has been reported that the  YHC3  sequence on chromosome X corre-sponds to the human  CLN3  gene and that the protein encoded by YHC3 (accessionNo. Z49334; also identified as YJL059w by T. M. Pohl and J. Aljinovik, though notpublished) has 36 %  identity to and 56 %  similarity with the human CLN3 protein(Mitchison  et al.,  1997). D. A. Pearce and F. Sherman designate the same sequenceas  BTN1  (Pearce and Sherman, 1997). The high homology of   YHC3  with human CLN3  indicates a strong evolutionary conservation of function, suggesting thatyeast maybe a useful model to elucidatethe biological function of the CLN3 proteinin mammalian cells. We constructed  yhc3   deletion strains and found that themutant yeast was more sensitive than the wild type to the combined inhibitoryeffect of high temperature (39  C) and high pH (pH 8.5) on yeast proliferation. MATERIALS AND METHODSYeast Strains and Growth Conditions The parental yeast strain used in this study to disrupt the  YHC3  sequence, theyeast homologue of the human  CLN3  gene, is JK9-3d a/   (genotype:  MAT a/    ,trp1 leu2-3,112 his4 ura3-52 rme1 ) (Heitman  et al.,  1991). The two haploid strains,YHC3-20  (MAT a, trp1 leu2-3,112 his4 ura3-52 rme1 yhc3  : :kanMX4)  and YHC3-22  (MAT a, trp1 leu2-3,112 his4 ura3-52 rme1) , were derived from a single tetradas described in the following section on  YHC3  disruption. All strains were routinelygrown on complete medium containing 2 %  yeast extract, 1 %  peptone, and 2 % glucose (YPD) at 30  C. Yeast ( YHC3 ) Gene Disruption As described by Wach  et al.  (1994), the principle for the PCR-based genedisruption used in this study is presented in Fig. 1. The gene disruption cassette (a1.5-kb cDNA fragment) was synthesized and amplified from the plasmid pFA6–kanMX4 as the template using PCR with the hybrid primer pair 1 listed in TableI. The hybrid primers consist of 34 nucleotides of the  YHC3  gene and 20 nucleotidesof pFA6–kanMX4. The PCR reaction conditions were 1 cycle of 3 min at 94  C, 30cycles of 1 min at 94  C, 1 min at 55  C, and 2 min at 72  C, followed by 1 cycle of   A Model of Yeast to Study Batten Disease 673Fig. 1.  General strategy of PCR-targeted  YHC3  gene disruption using the pFA6–kanMX4module. (A) PCR reaction to generate the kanMX4 disruption cassette using pFA6–kanMX4as the template. P1 and P2 are hybrid primers. (B) Homologous recombination  in  v i v o  anddisruption of the  YHC3  gene by the kanMax4 cassette. (C) Selection of haploid  YHC3  disruptionclones through growing the cells in a G-418 YPD plate. 5 min at 72  C. Using the lithium acetate method (Gietz and Schiestl, 1991), thecassette with the kanMX4 module flanked by portions of   YHC3  gene sequence(nucleotides 307–340 at the 5   end and nucleotides 975–1009 at the 3   end) wastransformed into wild-type diploid strain JK9-3d a/  . G418-resistant clones wereselected on YPD plates with 200   g/ml G418. To verify that transformants repre-sented the integration events into the genome by homologus recombination at thedesired locus, genomic DNA was prepared and analyzed by PCR with the primerpairs 2 and 3 from Table I. Two of the four PCR primers were located upstreamof the ATG site and downstream of the stop codon, respectively, of the  YHC3  674 Guo, Mao, Obeid, and BoustanyTable I.  Primers Used for PCRPrimer pair Oligonucleotide sequence (pFA6–kanMX4 sequencesno. underlined) Purpose1 F: 5  -TCTTCCGGATTTGGAGAAGTGACATTC  YHC3  knockoutCTACAGCGCATAGGCAC TAGTGGATCTGR: 5  -TTAATATCATCACCGCCCAGGGCGAATGTGGACACAGCTGAAGCTTCGTACGC2 F: 5  -CAGCAGCTGTTGATATCGT (YHC3 upstream Verification of nucleotides 83–101)  YHC3  knockoutR: 5  -CACAGCTGAAGCTTCGTAC (pFA6–kanMX3  -end nucleotides)3 F: 5  -CATAGGCCACTAGTGGATCT (pFA6–kanMX5  -end nucleotides)R: 5  -TCTAGCCCCAAACCAAGTAACGC (YHC3downstream nucleotides 1147–1169) gene, and the other two primers were located at the 5   end and the 3   end of the pFA6–kanMX4 cassette, respectively. Genomic integration of the disruptioncassette was verified using the  YHC3  upstream and the 3  end pFA6–MX4 primerpair as well as with the  YHC3  downstream and the 5  end pFA6–kanMX4 primerpair. The diploid cells carrying the  yhc3  allele were sporulated, and tetrads weredissected as described previously (Kassir and Simchen, 1991) to isolate the haploidstrains bearing the  yhc3  allele. Phenotypic Examination Yeast strains were grown in liquid culture medium on a shaking incubator at300 rpm. The initial density of the yeast was at 5    10 5 cells/ml. The density of yeast in liquid medium was measured at 600 nm using a spectrophotometer. Theratio of cell numbers as determined by the OD and direct counting was 0.8 forboth the wild-type and the mutant strains. The drugs used to treat yeast cellsincluded etoposide, vincristine, staurosporine, and oligomycin that were purchasedfrom Sigma. Oligomycin was a mixture of oligomycins A, B, and C. For the heatstress response, yeast strains were grown at 39  C for 24 hr. To observe the sensitivityof mutants to culture medium pH, the initial YPD culture medium (pH 6.3) wasadjusted to pH 5, pH 7.5, and pH 8.5, respectively. RESULTS AND DISCUSSION The disruption strains were evaluated side by side with wild-type siblings fromthe same parent strain (JK9-3d). There was no statistically significant difference inthe size of the wild-type and mutant yeast cells (4.33    0.56 and 4.45    0.56   m,respectively;  P   0.4275). The results that both the G418-sensitive wild-type clone(YHC3-22) and the G418-resistant mutant clone (YHC3-20) grew on YPD mediumat 30  C indicate the  YHC3  is not an essential gene for yeast.  A Model of Yeast to Study Batten Disease 675 Response to Heat Stress In order to test the response of   YHC3  deleted strains to heat stress, the growthof yeast cells was assessed in liquid YPD medium. Exponential growing yeast wasdiluted to an initial density of approximately 5    10 5 cells/ml and cultured at39  C for 24 hr. To ensure that any phenotypic change results from heat stress, wesimultaneously examined cell growth from the same diluted cultures at 30  C. Theresults showed that there was no growth difference between the wild type and themutant at 30  C (data not shown), while cell proliferation of   yhc3  strains at 39  Cwas mildly lower than that of wild-type strains at all incubation time points (Fig.2). After 18 hr, the cell number of YHC3-20 was markedly lower, at about 80 % that of YHC3-22. These results indicate that  YHC3  strains are more sensitive toheat stress than wild-type strains.In general, sensitivity to heat stress in yeast indicates a defect in genes whosefunctions are involved in the regulation of cellular events, such as replication,transcription, translation, and cell cycle control (Hartwell, 1967). In recent studieswith mammalian cells, we have demonstrated that the human  CLN3  gene plays akey role in cell survival by modulating ceramide signaling (Puranam  et al.,  1999).Additionally, ceramide has shown to be involved in the heat stress response of yeast(Jenkins  et al.,  1997). Exposure of yeast to ceramide can induce dose-dependentinhibition of proliferation (Jenkins, 1998). The specific phenotype of sensitivity of   yhc3  mutants to heat stress provides a clue that the  YHC3  gene may have a similarbiological function in yeast as it does in the human  CLN3  homologue in controllingcell proliferation. Response to pH Stress Another phenotypic difference seen in the present study is the sensitivity of   yhc3  strains to alkaline culture medium. We first assessed the effect of pH values Fig. 2.  Effect of heat stress on cell proliferationof   S. cere v isae.  Cells (wild type, YHC3-22; andmutant, YHC3-20) were seeded at an initial den-sityof5  10 5 cells/mlin5mlYPDliquidmediumand incubated at 39  C for 24 hr. Proliferationwas determined at 6, 12, 18, and 24 hr by ab-sorbance at 600 nm. Each assay was performedin triplicate, and data points are expressed asmean    SD. *The cell number in the mutant issignificantly less than that in the wild type( P     0.05).
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks