Business & Finance

A Natural Structural Variant of the Mouse TCR Chain Displays Intrinsic Receptor Function and Antigen Specificity1

Description
The C0 alternate cassette exon is located between the J1 and C1 genes in the mouse TCR -locus. In T cells with a VDJ1 rearrangement, the C0 exon may be included in TCR transcripts (herein called TCR-C0 transcripts), potentially inserting an
Published
of 9
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  of September 30, 2015.This information is current as Function and Antigen Specificity-Chain Displays Intrinsic Receptor β TCR A Natural Structural Variant of the Mouse and Janet L. MaryanskiA. Vignali, Olivier Michielin, Juan Carlos Zúñiga-Pflücker Takahashi, Yongoua Sandjeu, Philippe Guillaume, Dario A.Hamrouni, Andrea L. Szymczak-Workman, Tomio Anne Aublin, Maria Ciofani, Nancy Willkomm, Abdelbassethttp://www.jimmunol.org/content/177/12/8587doi: 10.4049/jimmunol.177.12.85872006; 177:8587-8594; ;  J Immunol References http://www.jimmunol.org/content/177/12/8587.full#ref-list-1, 19 of which you can access for f ree at: cites 47 articles This article Subscriptions http://jimmunol.org/subscriptions is online at: The Journal of Immunology Information about subscribing to Permissions http://www.aai.org/ji/copyright.htmlSubmit copyright permission requests at: Email Alerts http://jimmunol.org/cgi/alerts/etocReceive free email-alerts when new articles cite this article. Sign up at: Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2006 by The American Association of 9650 Rockville Pike, Bethesda, MD 20814-3994.The American Association of Immunologists, Inc., is published twice each month by The Journal of Immunology   b  y g u e  s  t   on S  e  p t   e m b  e r  3  0  ,2  0 1  5 h  t   t   p :  /   /   w w w . j  i  mm un ol   . or  g /  D o wnl   o a  d  e  d f  r  om  b  y g u e  s  t   on S  e  p t   e m b  e r  3  0  ,2  0 1  5 h  t   t   p :  /   /   w w w . j  i  mm un ol   . or  g /  D o wnl   o a  d  e  d f  r  om   A Natural Structural Variant of the Mouse TCR   -ChainDisplays Intrinsic Receptor Function and Antigen Specificity 1 Anne Aublin,* † Maria Ciofani, ‡ Nancy Willkomm,* † Abdelbasset Hamrouni, 2 * § Andrea L. Szymczak-Workman, ¶ Tomio Takahashi,* § Yongoua Sandjeu,* † Philippe Guillaume,  Dario A. A. Vignali, ¶ Olivier Michielin,  Juan Carlos Zu´n˜iga-Pflu¨cker, ‡ and Janet L. Maryanski 3 * † The C  0 alternate cassette exon is located between the J  1 and C  1 genes in the mouse TCR   -locus. In T cells with a VDJ  1rearrangement, the C  0 exon may be included in TCR   transcripts (herein called TCR  -C  0 transcripts), potentially insertingan additional 24 aa between the V and C domains of the TCR  -chain. These TCR  splice isoforms may be differentially regulatedafter Ag activation, because we detected TCR  -C  0 transcripts in a high proportion ( > 60%) of immature and mature T cellshaving VDJ  1 rearrangements but found a substantially reduced frequency ( < 35%) of TCR  -C  0 expression among CD8 T cellsselected by Ag in vivo. To study the potential activity of the TCR  -C  0 splice variant, we cloned full-length TCR cDNAs bysingle-cell RT-PCR into retroviral expression vectors. We found that the TCR  -C  0 splice isoform can function during an earlystage of T cell development normally dependent on TCR  -chain expression. We also demonstrate that T hybridoma-derived cellsexpressing a TCR  -C  0 isoform together with the clonally associated TCR   -chain recognize the same cognate peptide-MHCligand as the corresponding normal   TCR. This maintenance of receptor function and specificity upon insertion of the C  0peptide cassette signifies a remarkable adaptability for the TCR   -chain, and our findings open the possibility that this spliceisoform may function in vivo.  The Journal of Immunology,  2006, 177: 8587–8594. A lternative splicing of pre-mRNA transcripts is a majormechanism for the structural and functional diversifica-tion of mammalian genes, and proteins encoded bysplice variants control multiple processes of lymphocyte develop-ment, activation, and effector function (1). T lymphocytes recog-nize Ags as complexes of foreign peptides presented by MHCmolecules (pMHC) 4 via clonally distributed, heterodimeric   TCRs (2–4). The paired TCR   - and   -chains have very shortcytoplasmic tails lacking signal transduction capacity, and receptorfunction requires association of the   TCR with CD3  ,   ,    , and    signal transduction proteins (5, 6). Specific pMHC ligand rec-ognition occurs at the molecular surface formed by the CDR loopsencoded by rearranged TCR VJ   and VDJ   genes. After transcrip-tion, the rearranged VJ   and VDJ   sequences are spliced to thefirst exons of their respective C   or C   genes to form maturemRNAs encoding TCR   - and -  -chains. Two D-J-C   gene clus-ters are located in the  Tcrb  locus, and in mice an alternate exontermed “C  0” is located in the intervening sequence that separatesthe J  1 genes from the C  1 gene (7). In cells having a V-D-J  1rearrangement, the C  0 exon can be alternatively spliced in be-tween the rearranged VDJ  1 sequence and the first exon of theC  1 gene, potentially adding a 24-aa-long peptide cassette be-tween the V and C domains of the TCR   -chain. However, it is notknown whether such transcripts (hereafter called TCR  -C  0) aretranslated into protein nor whether they are functional (7, 8).We investigate the potential regulation of TCR   splice isoformexpression by single/oligo cell RT-PCR analysis of TCR  -C  0expression at various stages of T cell development and after Agactivation in vivo. We cloned full-length TCR cDNAs by singlecell RT-PCR and show that the TCR  -C  0 transcript can be trans-lated into protein and can function at the critical   -selection check-point of early T cell development. We also demonstrate that Thybridoma-derived cells doubly transduced with clonally derived,paired TCR  - and TCR  -C  0 constructs express cell surfaceTCRs and can be stimulated by cognate pMHC for IL-2 secretion.This maintenance of TCR function and specificity upon insertion of the C  0 cassette peptide opens the intriguing possibility that a newreceptor function may have coevolved with the C  0 exon in mice. Materials and Methods  Mice and cell lines DBA/2 and RAG-2-deficient (9) mice were maintained at our animalfacilities under procedures approved by our institutional animal carecommittees. The derivation and culture of OP9-DL1 cells and P815 cells *Institut National de la Sante´ et de la Recherche Me´dicale Unite´ 503, Lyon, France; † Universite´ Claude Bernard Lyon I, Lyon, France;  ‡ Department of Immunology, Uni-versity of Toronto, Sunnybrook Research Institute, Toronto, Ontario, Canada;  § EcoleNormale Supe´rieure de Lyon, Lyon, France;  ¶ Department of Immunology, St. JudeChildren’s Research Hospital, Memphis, TN 38105; and   Ludwig Institute for CancerResearch, Lausanne Branch, University of Lausanne, Epalinges, SwitzerlandReceived for publication June 14, 2006. Accepted for publication September29, 2006.The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked  advertisement   in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact. 1 M.C. is supported by a Canadian Institutes of Health Research Doctoral ResearchAward. D.A.A.V. and A.L.S.-W. are supported by the National Institutes of Healthand the American Lebanese Syrian Associated Charities, J.C.Z.-P. is supported by aCanada Research Chair in Developmental Immunology, and the J.L.M. laboratory issupported by Institut National de la Sante´ et de la Recherche Me´dicale and La LigueContre le Cancer (Rhoˆne De´partement, France). 2 Current address: Institut National de la Sante´ et de la Recherche Me´dicale Unite´817, Institut de Recherche sur le Cancer de Lille, Lille, France. 3 Address correspondence and reprint requests to Dr. Janet L. Maryanski at the currentaddress: Institut National de la Sante´ et de la Recherche Me´dicale Unite´ 576, Hopitalde l’Archet, 151 Route de Saint-Antoine de Ginestie`re, Boıˆte Postale 3079, 06202Nice Cedex 3, France. E-mail address: maryanski@cervi-lyon.inserm.fr ormaryanski@unice.fr 4 Abbreviations used in this paper: pMHC, peptides presented by MHC molecules;CSC, chondroitin sulfate c; DN, double negative; DP, double positive; i.c., intracel-lular; SN, supernatant; Pb, Polybrene; SP, single positive; YFP, yellow fluorescentprotein. The Journal of Immunology Copyright © 2006 by The American Association of Immunologists, Inc. 0022-1767/06/$02.00   b  y g u e  s  t   on S  e  p t   e m b  e r  3  0  ,2  0 1  5 h  t   t   p :  /   /   w w w . j  i  mm un ol   . or  g /  D o wnl   o a  d  e  d f  r  om   (clone P1) are described elsewhere (10, 11). The 293-derived (EcoPack2; BDBiosciences) and GP  E86 (from P. Ohashi, Ontario Cancer Institute, To-ronto, Canada) retroviral packaging cell lines and the NIH-3T3 fibroblasts(from J. Baguet, Institut National de la Sante´ et de la Recherche Me´dicaleUnite 503, Lyon, France) were cultured in DMEM with added glutamine (2mM), HEPES (10 mM), gentamicin (40   g/ml) (final concentrations, allfrom Life Technologies), and 10% FCS (Dominique Dutscher). TheTCR  CD8   mouse T hybridoma-derived cell line 58CD8 (12) (from E.Palmer, University Hospital, Basel, Switzerland) was cultured in the abovemedium with 5% FCS and 2-ME (50   M; Invitrogen Life Technologies). Flow cytometry Purified or biotinylated mAbs, FITC-, PE-, or PE-Cy5-conjugated mAbs,and streptavidin-allophycocyanin were purchased from BD Bioscienceswith the exception of the CTVB10b-PE (anti-V  10 b ), CTVA8-biotin (anti-V  8), and anti-CD8  -PE-Cy5 conjugates, which purchased from CaltagLaboratories. Previously described procedures (13–15) for cell preparationand staining were used, and after staining, the cells were analyzed or sortedusing FACSCalibur or Vantage instruments (BD Biosciences).  RT-PCR amplification of partial TCR sequences Sorting conditions for single-cell RT-PCR were as described (13) exceptthat for double-negative (DN) and double-positive (DP) thymocytes, 3–10cells (instead of one) were sorted per microtube to compensate for thereduced frequency of cells expected to have TCR   transcripts using aparticular V   gene. Conditions for two-step nested RT-PCR amplification,gel migration, and sequencing of TCR   sequences from sorted cells wereas described (13). Primers for the first PCR were Vb1-217 (ggaatgtgagcaacatctgg) or Vb10-136 (aaactctgggccacgatact) for V  1 or V  10, respec-tively, and Cb-523 (ctcagctccacgtggtca) for C  . Primers for the secondPCR were Vb1-279 (cgccagagctcatgtttctc) or Vb10-218 (gcaactcattgtaaacgaaaca) and Cb-480 (cgagggtagccttttgtttg). Amplified PCR products weredirectly sequenced to determine J   usage as described (13) by using prim-ers specific for V  1 (Vb1-333; tgcccagtcgttttatacctg) or V  10 (Vb10-seq;aggcgcttctcacctcagtcttca). To detect the expression of alternate spliceVDJ  1-C  0-C  1 transcripts from cells expressing a VDJ  1 transcript, anadditional nested second PCR was performed (from the first PCR) usingV  10- or V  1-specific primers (Vb1-279 or Vb10-218) together with aC  0-specific primer, Cb0–439 (tgagatgtaagagagctgtggtg). Single-cell RT-PCR amplification and cloning of full-length TCRcDNAs Frozen samples of single CD8 T cells specific for the pCW3/  K  d ligandpreviously sorted from mouse M-33 under RT-PCR conditions (13) wereused to amplify cDNAs corresponding to full-length TCR   and TCR  transcripts. The first PCR was performed in a final volume of 50   l con-taining 1 U of   Taq  polymerase in the manufacturer’s 1   reaction buffer(Roche), 2.85 mM MgCl 2  (Roche), 200   M each dNTP (Promega), and100 nM each primer. Primers for the first PCRs were L-Vb10-279 (cttatttgccctgccttgac), Cb1-1855 (aggcattttccaggtcacaa), Cb2-1174 (tttagtctgtttcagagtcaaggtg), L-Va8-178 (actcaaggaccaagtgtcatttc), and 1163-Ca-IVS(gattgtgaatcagggccaac). The first PCR program begins at 95°C for 2 min,continues with 35 cycles of 10 s at 95°C, 45 s at 59°C, and 1 min 30 s at72°C, and ends with 5 min at 72°C.Separate second “diagnostic” PCRs were performed using internal prim-ers to determine which samples were positive for TCR   or TCR  . For thediagnostic PCRs, a 0.5-  l aliquot of the first PCR was added to a finalvolume of 50   l containing 0.5 U of   Taq  polymerase with the recom-mended 1    reaction buffer (Roche), 1.75 mM MgCl 2  (Roche), 200   Meach dNTP (Promega), and 100 nM each primer. Primers for TCR   wereVb10-218 (gcaactcattgtaaacgaaaca) and Cb-480 (cgagggtagccttttgtttg), andthe primers for TCR   were L-Va8-178 (actcaaggaccaagtgtcatttc) and Ca-533 (aacgttccagattccatggtt). The positive PCR products were sequenceddirectly using a BigDye sequencing kit (Applied Biosystems) with theVb10-seq primer (aggcgcttctcacctcagtcttca) for TCR   and theVa8-rev-493(aggagctgctgctcttatgg) and Ca-516 (ggttttcggcacattgattt) primers forTCR  . Sequences were analyzed on an ABI PRISM 3100 genetic an-alyzer (Applied Biosystems).To amplify TCR sequences for cloning, separate second “cloning” PCRswere performed in quadruplicate by amplification of 3   l of the selectedfirst PCR using the  Bam HI-LVb10 (cgcccaggatccactatgggctgtaggctcctaagctgtgtgg) and Cb1-TGA-  Xho I (ccgcgcctcgagtcatgaattctttcttttgaccatagc)primers for the full-length TCR   and the  Bam HI-Va8-M33–235 (cgcccaggatcccttctatgaacatgcgtcctg) and  Xho I-Ca-TGA (ccgcgcctcgagtcaactggaccacagcctc) primers for the full-length TCR  . The forward primers incor-porate a  Bam HI restriction site and the ATG codon that initiates the V  10or V  8 leader sequences, and the reverse primers incorporate an  Xho I siteand the TGA termination codon for the C  1 or C   sequences. The PCRconditions were as described above for the diagnostic PCR, except that thepolymerase used was the Expand High Fidelity  Taq  (Roche). The secondcloning PCR program begins at 95°C for 2 min and 72°C for 5 s, continueswith 35 cycles of 10 s at 95°C, 1 min at 61°C, and 1 min 30 s at 72°C, andends with 5 min at 72°C.The pMIG2 and pMIY2 plasmids were derived from bicistronic murinestem cell virus-based retroviral vectors that encode GFP or yellow fluo-rescent protein (YFP), respectively, by introducing a new multiple cloningsite (sequence gaa ttc aga tct tac gta gct agc gga tcc caa ttg ctc gag) into the  Eco RI/   Xho I site 5  of the internal ribosome entry site sequence (16). Clon-ing was performed after  Bam HI/   Xho I digestion of the vector and the gel-purified PCR products. After an initial screening by PCR amplification andsequencing, selected colonies were subcloned and the plasmids were pu-rified (EndoFree plasmid maxi kit; Qiagen) for transfection and for se-quencing of the complete inserts. The cloned TCR sequences are availableunder GenBank accession numbers DQ126340 (TCR  ), DQ126341(TCR  -C  0), and DQ186679 (TCR  ). Transduction of 3T3 fibroblasts or 58CD8 cells and cell sorting Supernatants (SNs) containing viral particles for transduction were pro-duced by transient or stable transfection of the 293-derived (EcoPack2; BDBiosciences) or GP  E86 retroviral packaging cell lines, respectively, asdescribed (16, 17). Transduction of NIH-3T3 fibroblasts was performedwith a retroviral SN in the presence of Polybrene (Pb; Sigma-Aldrich,catalog no. H9268) as described (16).A protocol involving virus-copolymer complex formation and centrifu-gation (18) was adapted for the transduction of 58CD8 cells. Frozen viralSNs in 2-ml Eppendorf tubes were rapidly thawed (37°C) and mixed firstwith Pb and then with chondroitin sulfate C (CSC; Sigma-Aldrich, catalogno. C4384), with vigorous mixing after each addition. Stock solutions of each polymer were 20 mg/ml, and the final concentration of each was 80  g/ml. After a 20-min incubation at 37°C, the virus-Pb/CSC mixtures werecentrifuged 5 min in a tabletop Heraeus Biofuge Pico centrifuge at10,000  g , and the pellets containing virus-Pb/CSC complexes were re-suspended in culture medium in a volume 10-fold reduced as comparedwith the srcinal viral SN. Medium from the wells of flat-bottom 96-wellplates plated the previous day at 5000 58CD8 cells per well was removedand replaced with the virus-Pb/CSC mixture. After 24 h of incubation withthe viral complexes, the cells were transferred into 24-well plates.The 58CD8 cells were first transduced with the TCR  -MIY2 construct.Seven days later, 58CD8-YFP  cells were sorted as YFP low or YFP high populations and, 5 days after sorting, the 58CD8-YFP low , 58CD8-YFP high ,and 58CD8 cells were separately transduced with MIG2, TCR  -MIG2, orTCR  -C  0-MIG2 viruses. Five weeks later, the 58CD8-TCR  high  /TCR  and 58CD8-TCR  high  /TCR  -C  0 groups were labeled with 2C11-biotin/ streptavidin-allophycocyanin and sorted as surface CD3   cells. OP9-DL1 cocultures RAG-deficient hemopoietic progenitor cells from day 14 fetal liver werecultured on OP9-DL1 monolayers in the presence of 1 ng/ml IL-7 and 5ng/ml Flt-3L, after which the cells were infected by overnight culture onMIG2, TCR  -MIG2, or TCR  -C  0-MIG2 viral producer monolayers asdescribed (10, 14). The following day, GFP   /CD44  CD25  (DN3) cellswere sorted and cocultured on OP9-DL1 monolayers for a further 6 days. Stimulation of 58CD8-TCR transductants and IL-2 assay 58CD8-TCR transductants (60,000 cells/well) were incubated in 96-wellplates (Falcon Plastics) with  K  d  P815 cells (50,000 cells/well) in thepresence of pCW3 170–179  and pA24 170–179  (19) or in wells precoated over-night with the 2C11 mAb (BD Biosciences). Supernatants were collectedafter 48 h of culture. IL-2 concentrations were measured with a CBAmouse IL-2 flex set using a FACSCalibur and FCAP Array software (allBD Biosciences). Searching for conformational space accessible to C   0 loops ina model   TCR A homology model of the TCR   /TCR   heterodimer was built based on the2C TCR template (Protein Data Bank code identifier 1TCR) by satisfactionof spatial restraints using the Modeler program (20); the   - and   -chainswere aligned separately using a dynamic programming method imple-mented in the Modeler program. The sequence identity was 73 and 69% forthe   - and   -chains, respectively. The alignment was compared with pre-aligned TCR sequences (21) to insure that all conserved sequence motifswere correctly assigned. The 2C TCR template was chosen because its 8588 RECEPTOR FUNCTION OF A NATURAL TCR VARIANT   b  y g u e  s  t   on S  e  p t   e m b  e r  3  0  ,2  0 1  5 h  t   t   p :  /   /   w w w . j  i  mm un ol   . or  g /  D o wnl   o a  d  e  d f  r  om   combined    and    sequence identity was the highest among all of thecrystallized TCR structures. The heterodimer complex was subsequentlyobtained by simultaneous global optimization of alignment-derived re-straints for both the   - and   -chains. Similarly, a model for the TCR   / TCR  -C  0 heterodimer was produced by realigning the C  0-containingTCR   sequence (TCR  -C  0) with that of the 2C TCR   -chain. C  0 in-sertion resulted in a unique 24-residue gap opening at the V   and C  domain junction (data not shown). In the resulting TCR model, C  0 formsa loop that was subsequently refined using an ab initio approach imple-mented in the loop refinement routine of the MODELLER program forwhich default parameters were used; the conformational space of the loopwas searched using 1000 simulated annealing cycles involving the entireC  0 loop, with the rest of the TCR being kept rigid during the dynamics. Results TCR  -C   0 transcript expression during T cell development and after Ag stimulation in vivo Earlier studies detected TCR  -C  0 transcripts in peripheral Tcells and in unseparated fetal and adult thymocytes (7, 8). Mostthymocytes are CD4  CD8  DP cells already expressing   TCRs,and  5% represent cells of the less mature CD4  CD8  DN stagein which the TCR   -chain is associated with the pre-TCR   -chainin a CD3-associated pre-TCR complex (22, 23). The pre-TCR con-trols the   -selection checkpoint that allows proliferation and dif-ferentiation to the DP stage (23). To analyze the frequency of TCR  -C  0 transcript expression at different stages of T cell de-velopment, we performed RT-PCR on various subpopulations of thymocytes and peripheral T cells sorted under single- or oligo-cell(1–10 cells per tube) conditions. We amplified V  1- or V  10-TCR   cDNAs and sequenced the PCR products to assign J  1 orJ  2 gene usage. Our analysis shows that the majority of VDJ  1transcript-positive cells, from DN thymocytes (  66%) tomature peripheral T cells (60%), coexpress the TCR  -C  0isoform (Table I ) .To find out whether the TCR  -C  0 isoform might be differen-tially expressed after T cell activation, we analyzed its expressionex vivo among Ag-selected CD8 T cells. DBA/2 mice immunizedwith P815-CW3 cells undergo a high magnitude CD8 T cell re-sponse focused mainly on a ligand defined by pCW3 170–179  pre-sented by the H-2K d MHC class I molecule (pCW3/  K  d ) (13, 24–26). The TCR  -C  0 isoform can only be expressed in cells withVDJ  1 rearrangements (7), and J  1 gene usage is preferentialamong the V  10-TCRs that characterize the pCW3/  K  d -specificrepertoire (13, 19, 27). By single-cell RT-PCR and sequencing, wecompared TCR  -C  0 transcript expression among pCW3/  K  d -spe-cific CD8 T cells sorted at the peak of the response with that of V  10  CD8 cells from normal DBA/2 mice. This analysis re-vealed that the proportion of V  10DJ  1  cells with detectableTCR  -C  0 transcripts was reduced by half (to 28.5%) amongpCW3/  K  d -specific CD8 T cells as compared with controls (60%)(Table I). Further investigation will be required to determinewhether reduced TCR  -C  0 expression after Ag activation resultsfrom a differential regulation of TCR   isoform splicing or from aselective loss of TCR  -C  0-expressing T cells. Single-cell RT-PCR amplification and cloning of full-length TCRcDNAs We developed a protocol to amplify full-length TCR cDNAs fromsingle cells and used frozen samples of FACS-sorted pCW3/  K  d -specific CD8 T cells from a mouse (M-33) with a previously char-acterized TCR repertoire (13). To amplify   -chain sequences, afirst PCR was performed with primers corresponding to sequences5   of the V  10-leader (primer L-Vb10–279) and 3   of the Cb1gene (primer Cb1-1855). Of 24 tubes that each contained a singlesorted V  10  pCW3/  K  d -specific CD8 T cell, 11 were positiveaccording to the second diagnostic PCR performed with internalV  10- and C  -specific primers, and sequence analysis confirmedthat all of these corresponded to V  10DJ  1 rearrangements (datanot shown). Because only two-thirds of the V  10 TCRs in therepertoire of this mouse (M-33) had been found to be rearranged toa J  1 segment (13), this represents an estimated efficiency for theamplification of full-length sequences of 69% (11 of 16). In onecell sample, we amplified TCR   and TCR  -C  0 cDNAs withidentical V  10DJ  1.3 rearrangements, corresponding to a TCRpreviously identified (code V  10-1.3-1b) from this mouse (13). Asecond cloning PCR was performed on this sample for cloning intothe pMIG2 vector. As expected, colonies corresponding to eitherthe TCR   (LVDJC) or TCR  -C  0 (LVDJC  0C) cDNAs wereobtained from a single cloning reaction. Table I.  Expression of TCR  -C   0 transcripts by immature and mature T cells a Cell SourceSortExperimentNo. (Mouse) Cells Sorted asTCR VGeneTotalTCRsPercentage J  1TCRs (%)C  0 among J  1-TCRs b No.Percentage(%) Thymus-N 5 DN V  1 28 46.4 10/13 76.91 DN V  10 13 53.8 6/7 85.73 DN V  10 12 50 4/6 66.73 DP V  10 22 54.5 7/12 58.31 V  10  DP V  10 28 50 9/14 64.31 V  10   /CD8 SP V  10 33 45.5 7/15 46.7PBL-N 1 V  10   /CD8  V  10 29 37.9 7/11 63.64 (M-35) V  10   /CD8  V  10 30 30 5/9 55.6(Combine) (59) (33.9) (12/20) c (60)PBL-CW3 6 (M-2) CD62L   /V  10   /CD8  V  10 91 86 27/78 34.66 (M-3) CD62L   /V  10   /CD8  V  10 114 68 14/77 18.24 (M-33) pCW3K d   /V  10   /CD8  V  10 115 54 21/62 33.94 (M-34) pCW3K d   /V  10   /CD8  V  10 28 64 5/18 27.8(Combine) (348) (67.5) (67/235) c (28.5) a The indicated cell populations from normal (N) or CW3-immune (CW3) DBA/2 mice were sorted under oligo- (10 cells for DN, three cells for DP)or single-cell RT-PCR conditions (13). V  1- or V  10-TCRs were amplified using V  1/C   or V  10/C   primers, respectively, and the amplified PCRproducts were sequenced to determine J   usage. SP, Single positive. b TCR  -C  0 isoforms were identified by gel migration and/or by an additional second PCR performed using combinations of V  1/C  0 or V  10/C  0primers. Most TCR  -C  0 transcripts (  94%) were amplified together with a normal TCR   transcript. c Difference between PBL-N and PBL-CW3 is significant (  p  0.0054) by Fisher’s exact test. 8589The Journal of Immunology   b  y g u e  s  t   on S  e  p t   e m b  e r  3  0  ,2  0 1  5 h  t   t   p :  /   /   w w w . j  i  mm un ol   . or  g /  D o wnl   o a  d  e  d f  r  om   We next attempted to coamplify full-length TCR   and TCR  sequences from sorted single pCW3/  K  d -specific T cells from thesame mouse (M-33). For this purpose, the first PCR included amixture of primers specific for V  10, C  1, and C  2 and for V  8and C  . From a series of 24 sorted single cells, we amplified 11V  10-TCR   (including eight V  10DJ  1 and three V  10DJ  2)and three V  8-TCR   sequences. From two cell samples, se-quences corresponding to TCR  , TCR  , and TCR  -C  0 wereamplified. These correspond to   TCRs expressed by two differ-ent clones that we had previously identified (codes V  10-1.2-9c/ V  8P29-20c and V  10–1.3b/V  8P28–21c) (13). The TCR  fromthe latter was cloned into the pMIY2 vector because it is the clonalpartner for the TCR   (and TCR  -C  0) cloned above. To ourknowledge, this represents the first successful direct cloning of full-length TCR cDNAs from single cells. TCR  -C   0 alternate splice transcripts encode protein We first transduced 3T3 fibroblasts because they are efficient hostsfor retroviral vectors, and we performed intracellular (i.c.) stainingto detect TCR expression in these nonlymphoid cells. The TCR  -C  0 isoform was apparently translated into protein, because 3T3cells transduced with the TCR  -C  0 vector (3T3-C  0 cells) werepositive when stained with the C  -specific mAb, H57 (Fig. 1).However, neither of the two different V  10 b -specific mAbs thatstained the control 3T3-TCR   cells recognized the TCR  -C  0isoform, indicating that some V  10 epitopes may be altered ormasked by insertion of the C  0 peptide. The TCR  -C   0 isoform can function at the   -selectioncheckpoint  TCR gene rearrangement requires functional recombinase activat-ing genes (  Rag1  and  Rag2 ), and T cell development in RAG-deficient mice is blocked at the DN3 stage due to the absence of afunctional pre-TCR (9, 28, 29). We previously showed that retro-viral expression of a TCR   transcript in OP9-DL1 coculture-de-rived, RAG-deficient DN3 cells allows their development to the FIGURE 1.  Detection of TCR   and TCR  -C  0 proteins in 3T3 trans-ductants. Because the treatment for i.c. staining results in loss of GFP, itsexpression (FL1) was assessed on nonpermeabilized cells. 3T3 cells and3T3 cells transduced with TCR  -MIG2 or TCR  -C  0-MIG2 viral parti-cles were analyzed directly for FL1 (GFP) fluorescence (  A ) or were stainedi.c. with the indicated mAb- conjugates and analyzed for FL3 (PE-Cy5) orFL2 (PE) fluorescence (  B ). Gray histograms represent controls withoutmAb. The percentage of positive cells in the region defined by the markeris indicated for each histogram, as is the mean fluorescence intensity of thepositive cells. FIGURE 2.  The cloned TCR  -C  0 isoform drives the differentiation of RAG-deficient immature T cells to the DP stage. Day 14 fetal liver hemo-poietic progenitor cells from RAG-deficient mice were cocultured 7 dayswith OP9-DL1 cells, after which time the nonadherent (mostly DN3) cellswere infected by overnight coculture on MIG2, TCR  , or TCR  -C  0 pro-ducer cell monolayers. Sorted GFP   /CD44  CD25  cells were cultured onOP9-DL1 monolayers (day 0). At the indicated times, nonadherent cellswere recovered and stained with CD45 mAb (to exclude CD45  OP9-DL1-GFP cells) and CD4 and CD8 mAbs for FACS analysis. The CD4/ CD8 profiles are displayed, and the numbers in the quadrants represent thepercent of gated GFP   /CD45  cells. In an independent experiment (notshown) analyzed on day 4, we observed 0.4, 54, and 22% DP and 0.3-,187-, and 5.6-fold cell recovery, for MIG2, TCR  , TCR  -C  0, andgroups, respectively. FIGURE 3.  Surface TCR expression of 58CD8 cells doubly transducedwith TCR   and TCR  -C  0. Sorted 58CD8-TCR  high cells that had beenretransduced with TCR  , TCR  -C  0, or (empty) MIG2 viral particleswere surface stained with mAbs specific for V  8 (21.14-PE) and biotin-ylated mAbs specific for V  10 (B21.5), TCR-C   (H57), or CD3   (2C11),together with streptavidin-allophycocyanin, and analyzed by flow cytom-etry. Numbers indicate the percentage of cells in the respective quadrants.Sorted 58CD8-TCR  low cells retransduced with TCR  , TCR  -C  0, or(empty) MIG2 viral particles showed similar patterns when separatelystained with these mAbs (data not shown). FIGURE 4.  Correlated surface expression of TCR   and TCR  -C  0 on58CD8 transductants. Eighteen days after being sorted as surface CD3   cells, the 58CD8-TCR  high/  TCR   and 58CD8-TCR  high  /TCR  -C  0transductants were double-stained with anti-V  8 (B21.14-PE) and biotin-ylated mAbs specific for either V  10 (B21.5), C   (H57), or CD3   (2C11),together with streptavidin-allophycocyanin, and analyzed by flow cytom-etry. Numbers indicate the percentage of cells in the respective quadrants. 8590 RECEPTOR FUNCTION OF A NATURAL TCR VARIANT   b  y g u e  s  t   on S  e  p t   e m b  e r  3  0  ,2  0 1  5 h  t   t   p :  /   /   w w w . j  i  mm un ol   . or  g /  D o wnl   o a  d  e  d f  r  om 
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks