Self-Help

A naturally occurring rare analog of quercetin promotes peak bone mass achievement and exerts anabolic effect on osteoporotic bone

Description
A naturally occurring rare analog of quercetin promotes peak bone mass achievement and exerts anabolic effect on osteoporotic bone
Categories
Published
of 15
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  ORIGINAL ARTICLE A naturally occurring rare analog of quercetin promotespeak bone mass achievement and exerts anabolic effecton osteoporotic bone J. A. Siddiqui  &  G. Swarnkar  &  K. Sharan  &  B. Chakravarti  &  A. K. Gautam  &  P. Rawat  & M. Kumar  &  V. Gupta  &  L. Manickavasagam  &  A. K. Dwivedi  &  R. Maurya  & N. Chattopadhyay # International Osteoporosis Foundation and National Osteoporosis Foundation 2011 Abstract Summary  The effect of quercetin  C  -glucoside (QCG) onosteoblast function in vitro and bone formation in vivo wasinvestigated. QCG supplementation promoted peak bonemass achievement in growing rats and new bone formationin osteopenic rats. QCG has substantial oral bioavailability.Findings suggest a significant bone anabolic effect of QCG.  Introduction  Recently, we showed that extracts of   Ulmuswallichiana  promoted peak bone mass achievement ingrowing rats and preserved trabecular bone mass andcortical bone strength in ovariectomized (OVx) rats.3,3 ′ ,4 ′ ,5,7-Pentahydroxyflavone-6- C  - β - D -glucopyranoside,a QCG, is the most abundant bioactive compound of   U.wallichiana  extract. We hypothesize that QCG exerts boneanabolic effects by stimulating osteoblast function.  Methods  Osteoblast cultures were harvested from rat calvaria and bone marrow (BM) to study differentiationand mineralization. In vivo, growing female SpragueDawley rats and OVx rats with osteopenia were adminis-tered QCG (5.0 or 10.0 mg kg − 1 day − 1 ) orally for 12 weeks.Efficacy was evaluated by examining changes in bonemicroarchitecture using histomorphometric and microcom- puted tomographic analyses and by determination of new bone formation by fluorescent labeling of bone. Plasma andBM levels of QCG were determined by high-performanceliquid chromatography.  Results  QCG was much more potent than quercetin (Q) instimulating osteoblast differentiation, and the effect of QCGwas not mediated by estrogen receptors. In growing rats,QCG increased BM osteoprogenitors, bone mineral density, bone formation rate, and cortical deposition. In osteopenicrats, QCG treatment increased bone formation rate andimproved trabecular microarchitecture. Comparison withthe sham group (ovary intact) revealed significant restora-tion of trabecular bone in osteopenic rats treated with QCG.QCG levels in the BM were ~50% of that of the plasma levels. Conclusion  QCG stimulated modeling-directed bone ac-crual and exerted anabolic effects on osteopenic rats bydirect stimulatory effect on osteoprogenitors likely due tosubstantial QCG delivery at tissue level following oraladministration. Keywords  Estrogenicity.Flavonoid  C  -glucoside.Osteogenic.Peak bone mass J. A. Siddiqui and G. Swarnkar contributed equally to this study. Electronic supplementary material  The online version of this article(doi:10.1007/s00198-010-1519-4) contains supplementary material,which is available to authorized users.J. A. Siddiqui :  G. Swarnkar  :  K. Sharan : B. Chakravarti : A. K. Gautam :  N. Chattopadhyay ( * )Division of Endocrinology, Central Drug Research Institute(Council of Scientific and Industrial Research),Chattar Manzil, P.O. Box 173, Lucknow, India e-mail: n_chattopadhyay@cdri.res.inP. Rawat  : M. Kumar  :  R. Maurya Division of Medicinal & Process Chemistry, Central DrugResearch Institute (Council of Scientific and Industrial Research),Chattar Manzil, P.O. Box 173, Lucknow, India V. Gupta  :  A. K. DwivediDivision of Pharmaceutics, Central Drug Research Institute(Council of Scientific and Industrial Research),Chattar Manzil, P.O. Box 173, Lucknow, India L. ManickavasagamDivision of Pharmacokinetics and Metabolism, Central DrugResearch Institute (Council of Scientific and Industrial Research),Chattar Manzil, P.O. Box 173, Lucknow, India  Osteoporos Int (2011) 22:3013  –  3027DOI 10.1007/s00198-010-1519-4Received: 24 August 2010 /Accepted: 6 December 2010 /Published online: 12 January 2011  Introduction In animal models, dietary supplements and nutraceuticalsrich in flavonols including quercetin (Q) and kaempferolhave been reported to counteract the bone deleteriouseffects of estrogen deficiency without uterotrophic effect [1  –  3]. Although Q is not the most predominant flavonoid inour diet, it is one of the most studied among different dietary flavonoids [1, 4]. Q and one of its glucosides, quercetin-3- O -rutinose (also called rutin), are present infruits and vegetables. Q [3] and rutin [5] have been reported to inhibit ovariectomy (OVx)-induced osteopenia in rats.Bone sparing action of Q and rutin is thought to bemediated by anti-oxidant properties that attenuate the production of oxidation-derived free radicals from the boneresorbing osteoclasts and their precursors [6  –  10]. Q andrutin could also act through an estradiol receptor (ER), as phytoestrogens do [4, 11]. Several lines of evidence show that phytoestrogens can prevent bone loss, which has led totheir increased prophylactic use in postmenopausal women[12]. However, restoration of lost bone requires the use of  bone-forming agents, the so-called bone anabolics or osteogenic agents.Anabolic therapy or stimulating the function of bone-forming osteoblasts is the preferred pharmacological inter-vention for osteoporosis [13]. Parathyroid hormone (PTH;1  –  34) remains the only anabolic agent available for clinicaluse that has recently been recommended by FDA to carry a  black-box warning because it is associated with anincreased risk of osteosarcoma in rats. Intermittent PTH(iPTH) increases not only bone mass but also bone qualityand strength by improving microarchitecture and geometryof bone [14]. At the cellular level, iPTH exerts its anaboliceffect by increasing proliferation and differentiation of osteoprogenitors [15, 16], conversion of bone-lining cells to active osteoblasts [17, 18], and osteogenic differentiation of  mesenchymal precursor cells at the expense of adipogenesis[19, 20]. Inhibition of osteoblast apoptosis may also contribute to the anabolic action of iPTH since PTHtransiently reduces osteoblast apoptosis both in culture[21  –  24] and in vivo [21, 23]. Flavonols have been reported to promote osteoblast  proliferation, differentiation, and mineralization as well asincreasing production of osteoprogenitors [2, 25  –  31].Reports on the effects of Q on osteoblast function areconflicting. Q has been shown to stimulate differentiationof MG-63 osteoblast   “ like ”  cells via extracellular signal-regulated kinases and ER-mediated pathways [27] andincrease production of bone sialoprotein that has beenimplicated in the nucleation of hydroxyapatite crystals. Incontrast, Q has also been reported to induce apoptosis of MC3T3-E1, murine calvarial osteoblasts [32, 33]. Invari- ably, micromolar concentrations of Q or its analogs wererequired for stimulation of osteoblast functions in vitro that are not likely to be achieved in vivo, particularly at the bone tissue level. From these studies, it appears that Qcould serve as a   “ lead ”  pharmacophore for osteogenicactivity if potency and bioavailability of Q are enhanced.In our search for more potent analog(s) of Q withosteogenic effects, we undertook isolation of bioactivecompounds from a standardized, butanolic fraction (BF)from the stem bark of   Ulmus wallichiana  (Himalayan Elm).Stem-bark extract of   U. wallichiana  is known in Indiantraditional medicine to accelerate fracture repair [34, 35]. We have recently shown that the BF promoted peak bonemass achievement and prevented OVx-induced bone loss inrats [36]. Among the four compounds of BF that stimulatedosteoblast differentiation in vitro, 3,3 ′ ,4 ′ ,5,7-pentahydroxy-flavone-6- C  - β - D -glucopyranoside or quercetin-6- C  - β - D -glucopyranoside (QCG) was the most abundant. In OVxrats, QCG more effectively than Q improved bone biomechanical quality through positive modifications of BMD and bone microarchitecture without having hyper- plastic effect on uterus [3]. However, we did not system-atically evaluate the bone anabolic effect of QCG.Accordingly, the present study was designed to assessanabolic effect of QCG in growing as well as osteoporotic bones and its associated cellular mechanisms by usingculture systems and dynamic and static histomorphome-tries. Finally, since bioavailability is required for anycompound to exert biological effects, we determined oral bioavailability of QCG in rats. Materials and methods Reagents and chemicalsCell culture media and supplements were purchased fromInvitrogen (Carlsbad, CA, USA). All fine chemicalsincluding alendronate sodium trihydrate and 17 β -estradiol(17 β -E2) were purchased from Sigma Aldrich (St. Louis,MO, USA). High-performance liquid chromatography(HPLC) grade acetonitrile was obtained from Merck India Ltd (Mumbai, India). Heparin sodium injection(1,000 IU/ml IP) was purchased from Gland Pharma-ceuticals (Hyderabad, India) and human PTH (1  –  34)from EMD Chemicals (Gibbstown, NJ, USA). QCG was purified from the total ethanolic extract of the stem bark of   U. wallichiana  as described before [3].In vitro and in vivo studiesFor harvesting cultures from calvariae and bone marrow(BM) of Sprague Dawley rats, a prior approval from theInstitutional Animal Ethics Committee (IAEC) was 3014 Osteoporos Int (2011) 22:3013  –  3027  obtained. A separate approval from the IAEC was obtainedfor OVx, husbandry, and treatment of female SpragueDawley rats with various agents described in this study.Euthanasia and disposal of carcass were performed inaccordance with the guidelines laid by IAEC for animalexperimentation. Culture of calvarial osteoblasts For each experiment, about 25  –  30 calvariae were harvestedat room temperature from 1- to 2-day-old rats (both sexes).Briefly, individual calvaria was surgically isolated from theskull, sutures were removed, and adherent tissue materialwas cleaned by gentle scrapping. With the pooled calvariae,a previously described method of repeated digestion(15 min/digestion) with 0.05% trypsin and 0.1% collage-nase P was used to release cells [37]. After discarding thecells from the first two digestions, cells from the next threedigestions were pooled and cultured in  α  -MEM containing10% FCS and 1% penicillin/streptomycin (complete growthmedium). Cultures of rat calvarial osteoblasts (RCO) wereallowed to reach 80% confluence for other experimentsdescribed below.  ALP assay For the measurement of alkaline phosphatase (ALP)activity, RCO at ~80% confluence were trypsinized and2×10 3 cells/well were seeded onto 96-well plates. Cellswere treated with QCG (1, 10, or 100 nM) or vehicle for 48 h in  α  -MEM supplemented with 10% charcoal treatedFCS, 10 mM  β -glycerophosphate, 50  μ  g/ml ascorbic acid,and 1% penicillin/streptomycin (osteoblast differentiationmedium). At the end of incubation period, total ALPactivity was measured using  p -nitrophenylphosphate assubstrate and absorbance was read at 405 nm [38].To study the possible mediation of ER in the QCG-induced ALP production, 17 β -E2 (1 nM) and ICI-182780(1 nM), an anti-estrogen, were used. RCO were pre-treatedwith ICI-182780 for 30 min prior to QCG treatment, andALP production was determined as described above [39].  Mineralized nodule formation Mineralization of RCOs was performed following previ-ously published protocol [2, 40]. Briefly, RCO were seeded onto 12-well plates (25,000 cells/well) in osteoblast differentiation medium. RCO were cultured with or without QCG for 21 days with changing of medium every 48 h. At the end of the experiment, cells were washed with phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde in PBS for 15 min. The fixed cells werestained with alizarin red-S (40 mM, pH 4.5) for 30 minfollowed by washing with H 2 O [41]. Stained cells were first   photographed under light microscope, and alizarin stainwas then extracted by 10% ( v  /  v  ) acetic acid with shaking at room temperature for 30 min [40]. Cells were scrapped out of the culture plates, centrifuged (20,000×  g   for 15 min),and supernatant was collected. To the supernatant, 10% ( v  /  v  )ammonium hydroxide was added to bring the pH of thesolution to 4.5. Absorbance of the solution was read at 405 nm [2, 40, 42]. RCO represent osteoblasts from membranous bones that do not exhibit osteoporotic bone loss. Therefore, we alsostudied the effect of QCG on the mineralization of BMCfrom one of the bones (femora) that undergo bone lossunder E2 deficiency. BMC from 1-month-old female rats(~40 g) were harvested and cultured as described before [2,43]. Briefly, BMC from the femora was flushed out in20 ml osteoblast differentiation medium containing 10 − 7 Mdexamethasone (BM differentiation medium). Cells wereseeded (2×10 6 cells/well) onto 12-well plates in BMdifferentiation medium. BMC were cultured with or without QCG for 21 days with change of medium every48 h. At the end of the experiment, mineralized noduleswere stained and mineralization quantified as described incase of RCO. Quantitative real-time polymerase chain reaction SYBR green chemistry was used to perform quantitativedetermination of mRNA levels of runt-related transcriptionfactor 2 (Runx-2), bone morphogenetic protein-2 (BMP-2),osteocalcin, collagen type-1 (Col1), and the housekeepinggene, glyceraldehyde-3-phosphate dehydrogenase(GAPDH) from RCO treated with QCG following anoptimized protocol described before [40]. The design of sense and antisense oligonucleotide primers was based on published cDNA sequences using the Universal ProbeLi- brary (Roche Applied Sciences). Primer sequences arelisted in Table 1. cDNA was synthesized with theRevertAid cDNA synthesis kit (Fermentas, Austin, TX,USA) using 2  μ  g of total RNA in 20  μ  l reaction volume.For quantitative real-time polymerase chain reaction(qPCR), the cDNA was amplified using Light Cycler 480(Roche Molecular Biochemicals, Indianapolis, IN, USA). Studies on growing rats Twenty-one-day-old female rats were treated with 5.0- or 10.0-mg kg − 1 day − 1 dose of QCG or vehicle (gum acacia indistilled water) for 90 consecutive days by oral gavages.Gum acacia with distilled water is routinely used asthickening agent in pharmaceuticals as vehicle [2]. Follow-ing a previously published protocol, each animal receivedintraperitoneal injection of tetracycline (20 mg kg − 1 ) on Osteoporos Int (2011) 22:3013  –  3027 3015  days 4 and 54 and calcein (20 mg kg − 1 ) on days 40 and 68,respectively [36]. At autopsy, femora and tibiae weredissected out, cleaned for soft tissue, fixed in 70% ethanol,and stored at 4°C until the measurement of various bone parameters as described below.Pooled BMC from tibiae and femora of vehicle or QCG-treated rats were harvested, and mineralization was studied asdescribedintheprevioussection[2]. BMCwerethenculturedfor21daysinBMdifferentiationmedium.Mineralizationwasquantified as described in the previous section [40, 44]. Studies on OVx rats Forty adult female rats (weighing 200±20 g each) were bilaterally OVx and left untreated for 13 weeks prior to thestart of various treatments [45]. For the treatments, OVxrats were randomly divided equally into four groups asfollows: OVx + vehicle (gum acacia in distilled water),OVx+20  μ  g kg − 1 PTH (twice a week by intraperitonialinjection), OVx+3.0 mg kg − 1 day − 1 alendronate, and OVx+5.0 mg kg − 1 day − 1 QCG. In addition, ten adult female rats(200±20 g each) were sham-operated (ovary intact group)and given vehicle (control group). Since QCG had bonesparing effect in OVx rats at 5.0 mg kg − 1 day − 1 dose [3], weused the same dose for the current study. The dose regimenfor PTH used in this study was based on previous studies[46]. Treatments were continued for 12 weeks. For dynamic histomorphometry, each animal received intra- peritoneal injections of tetracycline (20 mg kg − 1 ) onday 60 (8 weeks) and calcein (20 mg kg − 1 ) on day 90(12 weeks) from the start of the various treatmentsincluding the vehicle-treated control groups. At the endof all treatments, rats were euthanized and autopsied tocollect bones (tibia, femur) for the measurement of bone parameters as described below.  Measurement of bone parameters Following previously described protocols, BMD measure-ment of isolated bones was performed using dual energy X-ray absorptiometry (DEXA; Model 4500 Elite, Hologic)fitted with commercially available software (QDR 4500ACCLAIM series) for a fan-beam DXA system that allowsdetermination of global (total) as well as regional BMD of isolated bones [2, 37]. For dynamic histomorphometric studies, tetracycline andcalcein labeled bones were processed as described before[36, 37]. At the end of the study, isolated bones were embedded in an acrylic material, and 50- μ  m sections weremade using Isomet Bone cutter (Buehler, Lake Bluff, IL,USA). Photograph of the sections was taken under fluorescent microscope aided with appropriate filters. Boneformation rate (BFR) and mineral appositional rate (MAR)were then calculated using Leica-Qwin software (Leica Microsystems GmbH) according to a previously describedmethod [47]. μ  CT scanning of excised bones was carried out usingthe Sky Scan 1076  μ  CT scanner (Aartselaar, Belgium)as described before [3, 45, 48]. The bone samples were scanned in batches of three at a nominal resolution (pixels)of 18  μ  m. Reconstruction was carried out using a modified Feldkamp algorithm using the Sky Scan Nreconsoftware, which facilitates network distributed reconstruc-tion carried out on four personal computers runningsimultaneously. The X-ray source was set at 70 kV and100 mA, with a pixel size of 18  μ  m. A hundred projections were acquired over an angular range of 180°.The image slices were reconstructed using the cone-beamreconstruction software version 2.6 based on the Feld-kamp algorithm (Skyscan). The trabecular bone wasselected by drawing ellipsoid contours with the CTanalyzer (CTAn, Skyscan) software. Trabecular bonevolume, trabecular number, and trabecular separation of femur epiphysis and proximal tibial metaphysis werecalculated by the mean intercept length method. Trabec-ular thickness was calculated according to the method of Hildebrand and Ruegsegger [49]. 3-D parameters were based on analysis of a Marching cubes-type model with a rendered surface. Cortical thickness, cortical area, cortical perimeter, periosteal perimeter, and endosteal perimeter  Gene name Primer sequence Accession number BMP-2 F  —  CGGACTGCGGTCTCCTAA NM_007553.2R   —  GGGGAAGCAGCAACACTAGAOsteocalcin F  —  ATAGACTCCGGCGCTACCTC NM_013414R   —  CCAGGGGATCTGGGTAGGCollagen type-1 F  —  CATGTTCAGCTTTGTGGACCT NM_053304R   —  GCAGCTGACTTCAGGGATGTRunx-2 F  —  CCACAGAGCTATTAAAGTGACAGTG NM_053470R   —  AACAAACTAGGTTTAGAGTCATCAAGCGAPDH F  —  TTTGATGTTAGTGGGGTCTCG NM_017008R   —  AGCTTGTCATCAACGGGAAG Table 1  Primer sequenceof various genes used for qPCR  301 Osteoporos Int (2011) 22:3013  –  30276  were calculated by 2-D analysis of cortical bones of femur (mid-diaphysis) and tibiofibula separating point (TFSP).To ensure consistent measurement of cortical parameters,the beginning of the growth plate served as reference point from where 250 serial image slides were discarded toexclude the trabecular region, and the following 200consecutive image slides (representing only cortical bone)were selected for analysis and quantification using CTAnsoftware.Determination of plasma and bone marrow levels of QCG  Animals, drug administration, and sampling  Adult female rats (200±20 g) were used for this study.The animals were first administered a 5.0-mg kg − 1  bolusdose of QCG by oral gavages and sacrificed at 0.25, 0.5,1, 3, 6, 8, 10, 12, and 24 h post-dosing. Three animalswere taken at each time point. Plasma and BM werecollected for the determination of QCG levels. Data that represent the concentration  –  drug profile at 0 h time point were obtained from animals without any previous QCGtreatment.Sample processing was performed as described before[48]. BM was harvested by repeated flushing of femur andtibia in PBS, as described before [2]. After centrifugationand removal of supernatants, wet weight of BM was notedand 50 mg BM was homogenized in 1 ml PBS. Theresultant samples were centrifuged at approximately9,000×  g   for 10 min and stored at   − 20°C until analysis performed. To 0.5 ml of plasma or BM samples, 1 ml of acetonitrile was added. The resulting solution was thor-oughly vortex-mixed for 2 min. After centrifugation at 3,000×  g   for 10 min, the supernatant layer was transferredinto a clean test tube, concentrated to dryness under vacuum, and reconstituted in 50  μ  l of acetonitrile. Fromthe reconstituted samples, aliquots of 20  μ  l were injectedinto the HPLC system for analysis.  Preparation of standard and quality control samples Stock solution of QCG was prepared in methanol togive a final concentration of 48  μ  g ml − 1 (103.44  μ  M).A series of standard solutions with concentration in therange of 96  –  576 ng ml − 1 (206 nM  –  1.24  μ  M) wasobtained by serial dilution method with methanol. To prepare the standard calibration samples, 50  μ  l of standard solutions was added to 250  μ  l of blank plasma or 500  μ  l of BM. The mixture was then treated followingsample extraction procedure described below. The qualitycontrol (QC) samples, which were used in the validation,were prepared in the same way as the standard calibrationsamples.  HPLC conditions The HPLC system was equipped with 10 ATVP binarygradient pumps (Shimadzu), a Rheodyne 7125 injector with20  μ  l injecting capacity (Cotati, CA, USA), and 10 ATVPdiode array detector (Shimadzu). HPLC separation was performed using a Lichrocart Lichrosphere C18 column(250 mm, 4 mm, 5  μ  m; Merck). Column effluent wasmonitored at a wavelength of 370 nm. Data were acquiredand processed using Shimadzu software. The mobile phasewas a mixture of potassium dihydrogen phosphate buffer (0.05 M; containing triethyl amine (0.1%) and pH adjustedto 2.5 with phosphoric acid) and acetonitrile, where theratio of buffer to acetonitrile was 65:35. Both the solutionswere filtered and degassed before use. Chromatographywas performed at 25±3°C at a flow rate of 1.5 ml/min.Statistical analysisData are expressed as mean ± SEM. The data obtained inexperiments with multiple treatments were subjected toone-way ANOVA followed by post hoc Newman  –  Keulsmultiple comparison test of significance using GraphPadPrism 3.02 software. Qualitative observations have beenrepresented following assessments made by three individ-uals blinded to the experimental designs. Results Effect of QCG on osteoblast differentiationFigure 1a  showsthechemicalstructureofQCG(  M  W  464). At 80% confluence, RCO from 1- to 2-day-old rats were treatedwith QCG and as shown in Fig. 1b, QCG stimulated ALPactivity in RCO at 10 and 100 nM compared to control (cellstreated with vehicle;  P  <0.001). We next studied the effect of QCG on mineralization and observed that at the highest concentration (100 nM) used for stimulating ALP activity inRCO, QCG stimulated mineralization of both RCO (  P  <0.01;Fig. 1c) and BMC (  P  <0.001; Fig. 1d). Next, we studied the effect of QCG on the expression of various osteogenic specific genes in RCO. Figure 1e showsthat 100 nM QCG treatment increased Runx-2 (  P  <0.01)and BMP-2 (  P  <0.01) mRNA levels over control at as earlyas 4 h. Increases in the mRNA levels of osteocalcin (  P  <0.05) and Col1 (  P  <0.05) by QCG treatment were noted at 24 h compared to control. Increases in the mRNA levels of all four osteogenic genes by QCG were found to continueup to 72 h. At 72 h, QCG increased mRNA levels of Runx-2 (  P  <0.01), BMP-2 (  P  <0.001), osteocalcin (  P  <0.001), andCol1 (  P  <0.01) compared to control. Q had no effect on anyof these osteogenic genes of RCOs at lower than 10  μ  M Osteoporos Int (2011) 22:3013  –  3027 3017
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks