Fashion & Beauty

Bovine paramphistomes in Ireland

Description
Bovine paramphistomes in Ireland
Published
of 10
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Pleasecitethisarticlein   pressas:Zintl,A.,etal.,   Bovineparamphistomesin   Ireland.Vet.Parasitol.(2014),http://dx.doi.org/10.1016/j.vetpar.2014.05.024 ARTICLE IN PRESS G Model VETPAR-7260;No.of    Pages10VeterinaryParasitologyxxx(2014)xxx–xxx ContentslistsavailableatScienceDirect Veterinary   Parasitology  jo   u   rnalhomepage:   www.elsevier.com/locate/vetpar Bovine   paramphistomes   in   Ireland Annetta   Zintl a , ∗ ,Andres   Garcia-Campos a ,Alan   Trudgett b ,Andreas   L.   Chryssafidis a ,Silvia   Talavera-Arce a ,Yan   Fu a ,SimonEgan a ,Amanda   Lawlor a ,Carmen   Negredo a ,Gerard   Brennan b ,Robert   E.   Hanna c ,TheoDe   Waal a ,Grace   Mulcahy a a UCDSchoolofVeterinaryMedicine,UniversityCollegeDublin,Ireland b SchoolofBiologicalSciences,QueensUniversityBelfast,UK  c VeterinarySciencesDivision,Agri-FoodandBiosciencesInstitute,Stormont,Belfast,UK  a   r   ti   c   le   i   n   f   o  Articlehistory: Received21March2014Receivedinrevisedform8May   2014Accepted11May   2014 Keywords: Paramphistomosis Calicophorondaubneyi EpidemiologyFaecaleggcountPhylogeneticanalysisNetworkanalysis ab   s   t   ra   ct Paramphistome   infections   have   been   associatedwith   significantmorbidity,   caused   chieflybythe   activity   of     juvenile   flukes   inthe   intestineof    the   ruminantfinalhost.   Most   caseshavebeen   reported   intropicalandsub-tropical   areas.   However,   recent   reports   of    an   apparentincrease   inthe   incidence   of    rumenfluke   anditsgeographicalrange   inEurope   haverenewedinterest   inaparasitepreviouslythought   to   be   of    little   significance   intemperate   regions.Moreover,   the   identity   of    rumen   flukes   presentinthe   BritishIsles   iscurrently   beingrevised.Asa   result,   work   isunderwaythroughout   Europe   toreview   andre-assess   the   clinicalandeconomic   significance   of    rumen   flukes.Duringthe   present   study,   historical   diagnostic   laboratoryrecords   wereinterrogatedforrecent   changesinthe   incidenceof    rumen   fluke   in   Ireland.   Threecattleherds   were   mon-itoredfor   the   presenceof    paramphistome   eggsusingcoprological   analysis   overaperiodof    2months   (in   the   case   of    a   groupof    housed   steers)   and   14months   (in   the   caseof    twoextensively   operated   farms),   respectively.   Adultrumenfluke   collected   following   slaugh-ter   were   weighed   and   typedintwo   loci.We   foundthat Calicophoron   daubneyi   isthe   mostcommon   if    not   only   paramphistome   species   present   inIreland   and   thatinfections   incat-tle   arenow   muchmoreprevalent   thanwasthe   casefiveor   sixyears   ago.Thepylogeneticrelationship   of    ourisolatesto   the   onlypublishedsequenceand   to   C.daubneyi   isolates   fromNorthern   Ireland   was   analysed.   Genetic   heterogeneity   wassimilaralloverthe   islandandcomparable   to   that   of    Fasciolahepatica ,   afact   that   may   have   implications   for   the   parasite’sability   todevelop   resistanceto   the   very   limited   number   of    drugs   currentlyavailablefortreatment.   The   samehaplotypes   predominated   throughout   the   island.   Although   the   clini-calsignificance   of    C.daubneyi   is   stilluncertain,   considering   the   apparent   pervasivenessof the   parasite,rumen   flukeshould   be   consideredadifferential   diagnosis   when   treatingscouror   ill-thrift   inyoung   calves,and   goats   and   sheep   of    anyage.©2014   Elsevier   B.V.   Allrights   reserved. ∗ Correspondingauthor.Tel.:+35317166121;fax:+35317166185. E-mailaddresses: annetta.zintl@ucd.ie,   annetta.zintl@gmail.com(A.Zintl). 1.Introduction Paramphistomesaretrematodeparasiteswhichinfectallruminantlivestockincludingcattle,sheep,goatsanddeer.Theirlifecycleis   verysimilartothatof    theliverfluke, Fasciolahepatica .Motileciliatedmiracidiathathatch http://dx.doi.org/10.1016/j.vetpar.2014.05.0240304-4017/©2014ElsevierB.V.Allrightsreserved.  Pleasecitethisarticleinpressas:Zintl,A.,etal.,BovineparamphistomesinIreland.Vet.Parasitol.(2014),http://dx.doi.org/10.1016/j.vetpar.2014.05.024 ARTICLE IN PRESS G Model VETPAR-7260;No.ofPages102    A.Zintletal./VeterinaryParasitologyxxx(2014)xxx–xxx fromeggspassedinthefaecesof    aninfectedhost,invadeamphibiousoraquaticsnailswheretheymultiplyasexu-allyanddevelopto   cercariae.Theseareshedcontinuouslyforuptooneyear,encystingonvegetationasmetacer-cariae(DeWaal,2010).Uponingestionbythefinalhost, juvenilesexcystinthesmallintestinewheretheyattachfirmlytothegastrointestinalliningbydrawingplugsof mucosaintotheirventralsuckeroracetabulum(Singhetal.,1984).Eventuallytheflukesmoveto   therumenwheretheymatureandstartto   produceeggswhichareverysim-ilarintheirmorphologytoliverflukeeggs.Currently,thereisconsiderableconfusionovertheclas-sificationofparamphistomesasmanypreviouslydescribedspeciesappeartobesynonymous(Sey,1980;Tayloretal.,2007;DeWaal,2010).Moreover,theidentityofrumenflukespresentin   somepartsof    Europeis   beingrevised(Gordonetal.,2013).Asa   result,thereis   a   levelofuncer-taintyinthepublishedliteratureastotheidentityof thesnailintermediatehost,thelengthoftheprepatentperiodandthepathogenicityof    paramphistomes. Cali-cophorondaubneyi (formerlyknownas Paramphistomumdaubneyi )appearstoinfectthesameintermediatehostas F.hepatica ,theamphibioussnail, Galbatruncatula (Augotetal.,1996).Thereisdisagreement,however,whether G.truncatula cansustainconcurrentinfectionsofbothpara-sites(Abrousetal.,2000;Martínez-Ibeasetal.,2013).Accordingtosomereports Lymnaeafuscus and Lymnaea pallustris canalsoserveasintermediatehostsfor C.   daub-neyi (Abrousetal.,   2000).Aquaticsnail Planorbis and Bulinus spp.serveasintermediatehostsforotherparamphistomespeciesincluding Paramphistomumcervi , Paramphistomumichikawai , Calicophoroncalicophoron and Paramphistomum ( Calicophoron ) microbothrium (Rolfeetal.,   1991;Spenceetal.,1996;Mavenyengwaetal.,   2010;Pavlovi´cetal.,2012).Pathologyis   mostlyassociatedwiththeactivityof immatureflukesintheintestine,withseverityof    diseaseapparentlychieflydeterminedbyhowfarjuvenilesbur-rowintothemucosaandsubmucosallayers.Thisinturndependsnotonlyontheparamphistomespeciespresent,butalsothespecies,ageandimmunestatusofthehost.Asaresultclinicaldiseaseincattleisusuallyconfinedtoyoungstock,whilesheepandgoatsaresusceptiblethroughouttheirlives(Tayloretal.,   2007).Forexample,goatsinfectedwith P.cervi ,suffersevereinflammationasimmatureflukespenetratethemucosa,submucosaandeventhemuscularismucosaunderneath(Singhetal.,   1984).Similarly,juvenile P.micobothrium insheepcausestrangulationandnecrosisoftheintestinalmucosaresultinginseveregastroenteri-tis(reviewedinMavenyengwaetal.,   2010).Infectionwithimmature C.daubneyi flukeshasbeenassociatedwithvil-lousatrophyresultinginscourinsheep(Masonetal.,2012)andyoungcattle(Millaretal.,   2012).Adultflukesintherumen,ontheotherhand,seemtobewelltoleratedevenif presentinlargenumbers(Spenceetal.,   1996;Millaretal.,2012),althoughsomereportshavefoundanassociationwithsubclinicalanaemia,loweredfeedconversion,weightlossanddecreasedmilkyields(Rangel-Ruizetal.,   2003;Mavenyengwaetal.,2010).Reportedprepatentperiodsrangefrom5to11weeks(Boray,1959;Singhetal.,1984;Mavenyengwaetal.,   2010).Formanyyears,interestinparamphistomeswascon-finedtothetropicsandsubtropics,asthegroupwasconsideredrelativelynon-pathogenicandunimportantintemperateregions.However,morerecentlyreportsof clinicalparamphistomosisassociatedwithconsiderablemorbidityandmortalityhavebeenemerging,particu-larlyinBritainandIreland(Murphyetal.,2008;Murrayetal.,   2010;Masonetal.,2012;Millaretal.,   2012).Atthesametime,thereisevidencethat,mirroringchangesintheepidemiologyof    F.hepatica ,paramphistomeincidenceandgeographicalrangemay   beincreasing(reviewedbyMartínez-Ibeasetal.,2013;Gordonetal.,2013).Tocompoundtheissuefurther,a   recentmolecularstudyhasshownthat C.daubneyi ,andnot P.cervi asprevi-ouslythought,isthemostcommonspeciesintheUK(Gordonetal.,   2013).Itis   unclearatthispointwhetherthetwo   specieshavealwayscoexistedontheBritishIslesorwhethertherecentapparentincreasein   incidenceandclinicaldiseaseis   duetotheintroductionandspreadof    thisnewspecies.Ourstudycollatesepidemiologicalandmolecularinfor-mationaboutparamphistomesin   Ireland.Thisbackgroundinformationwillbe   usefulforevaluatingthelikelysignifi-canceof    rumenflukeforthelivestockindustryatpresentandintothefuture. 2.Materialsandmethods  2.1.Diagnosticlaboratoryrecords Theelectronicclinicalrecordsof    UniversityCollegeDublinVeterinaryHospital(UCDVH)werequeriedforthenumberof    paramphistome-positivecasesasa   percentageofallbovineandovinefaecalsamplesthatwerescreenedforthepresenceof    rumenflukeeggsbysedimentation(describedbelow)between2004and2013.  2.2.Fieldstudy Faecalsamplesfromthreecattleherds,situatedinthesoutheastof    theRepublicofIrelandincounties(A)Kildare,(B)Wexfordand(C)Tipperarywereregularlyscreenedforthepresenceof    paramphistomeeggs.Thethreeherdsrep-resenteddifferenttypesof    farmingoperations,i.e.   herdAwas   a   smallherdcomposedentirelyof    youngsteers(11–16months),herdBwasa   beefherdandherdCa   dairyopera-tion.HerdsBandCwereonpasturebetweenspringandautumnandhousedduringwinter.HerdA   washousedthroughout. F.hepatica isknowntobepresentonfarmsBandCbutthoughttobeabsentfromA.Theanimalswerenottreatedforeitherliverflukeorrumenfluke.Foreachsampleapprox.5gfaeceswereexaminedbysedimentation,followedbystainingwith5%methyleneblueandcountingof    eggsundera   lowpowerstereomi-croscope(Tayloretal.,2007).For   comparisonof    faecaleggcountsbetweensamplinglocationsandoccasions,countswerecategorisedinto0,+(<20eggspergramfaeces,epg),++(20–50epg)and+++(>50epgfaeces).Numbersof    ani-malsandsamplingschedulesonthevariousfarmsareoutlinedin   Table1.  Pleasecitethisarticlein   pressas:Zintl,A.,etal.,   Bovineparamphistomesin   Ireland.Vet.Parasitol.(2014),http://dx.doi.org/10.1016/j.vetpar.2014.05.024 ARTICLE IN PRESS G Model VETPAR-7260;No.of    Pages10  A.Zintletal./    VeterinaryParasitologyxxx(2014)xxx–xxx 3  Table   1 Locationandsizesofherdsscreenedforevidenceofparamphistomeinfections.HerdandlocationTypeNumberof    cattleintheherdSamplingschedulesA,KildareBeef,housedthroughout47   Bi-weeklyfromJune2013to    July2013B,   Wexford Beef,housedduringthewinter 60(at   thestart)to26(attheendof sampling) a Initialsample:November2012;Bi-monthlyfromMarch2013to    January2014C,   TipperaryDairy,housedduringthewinter89   (atthestart)to   69(attheendof sampling) a As   forB a Thesewerecommercialherdsandattritionwas   duetoanimalsgoingtoslaughter.  2.3.Collectionofrumenflukespecimens,sizeandPCR Atotalof196rumenflukeswerecollectedfromHerdsAandBfollowingslaughter.Anadditional48flukeswerecollectedfromothercattlethatarrivedintheabattoiratthesametime.All   flukeswerecleanedinsaline,blot-teddryontissuepaperandindividuallyweighed.TheweightsofflukescollectedfromanimalsinherdsAandBandfrom‘othercattle’werecomparedusingone-wayANOVA.Seventyflukes(25eachfromfarmsAandBand20from‘other’cattle)werefurtherprocessedformolecularanalysisasfollows.DNAwasextractedfromwholeflukesusingtheHighPurePCRtemplatepreparationkit(Roche).Allisolateswereamplifiedin   twoloci,thesecondinternaltranscribedspacer(ITS-2)of    ribosomalRNAgenetogetherwithfragmentsofthetwoflankingconservedsequences,5.8Sand28S(accordingtoRinaldietal.,2005)andthemitochondrialDNAencodingtransferRNA(tRNA-Thr)withpartialsequencesfromtheflankingcytochromeoxidasesubunitI(Cox1)geneandthelargesubunitribosomalRNAgeneasdescribedbyMartínez-Ibeasetal.(2013).AllPCRproductsweretreatedwithexonuclease1(NewEnglandBiolabs)andTsap(Promega)toremovefreeprimeranddNTP’spriortosequencinginbothdirections(GATCBiotech).BothPCRreactionswerecarriedoutin   atotalvolumeof50  l.For   ITS-2amplification,primerswereaddedat250nM,   dNTP’sat0.2mMeach,MgClat2mMandTaq(Go-TaqFlexi,Promega)at2.5U.FortRNA-Thr/Cox1amplificationthereactionmix   containedprimers(400nM),dNTP’s(0.2mM),   MgCl(2.5mM)   andTaq(1.25U).   Oneand2  lDNAtemplate(at   anapprox.concentrationof60ng/  l)wereaddedtothetwoamplificationreactionsrespectively.Primers,PCRandExoTsaptreatmentconditionsaresumm-arisedinTable2.Sequencesfromthe2lociwerealignedwitheachother(ClustalOmega)andcomparedto   theGenBankdatabase(Blastanalysis).  2.4.Phylogeneticanalysis Thelevelofheterogeneitybetweenampliconsof    thetRNA-Thr/Cox1locusandJQ815200,thesinglecorrespond-ingpublishedsequence,was   analysedbyconstructinganeighbour-joiningtree(MEGA5.2.2,Kumaretal.,2004).Treereliabilitywas   assessedbythebootstrapmethodwith1000pseudoreplicates.Thepercentageof    replicatetreesresultingin   thesameclustersisshownnextto   thebranches.A   MedianJoiningNetworkwasconstructedusingNet-work4.5(FlexusTechnologyLtd.)softwareinordertoinvestigatefrequencyanddistributionof    thevarioushap-lotypesfurther.For   thisanalysis,thedatasetalsoincludedtRNA-Thr/Cox127sequencesamplifiedfrominfectedcat-tleautopsiedattheVeterinarySciencesDivision(AFBI)inNorthernIreland.TheycontainedisolatesfromcountiesAntrim,ArmaghandDown.Haplotypeandnucleotidediversity(Hdand  )   werecalculatedusingDnaSPV5(LibradoandRozas,2009).Fornetworkandgeneticdiver-sityanalyses,the70sequencesfromherdsA,Band‘othercattle’weretrimmedtothesamelengthastheslightlyshorterisolatesequencesfromNorthernIreland.Nucleotidesequencedataforthehaplotypessequencedinthisstudy,designatedasIE1–IE16,areavailableinEMBL,GenBankTMandDDJBdatabasesunderAccessionnumbersKJ574046toKJ574061.  Table2 DetailsofPCRandExoTsapprotocols.ProtocolFragmentsize(bp) Primers(5 ′ -3 ′ )/enzymesConditionsITS-2428Fw:   TGTGTCGATGAAGAGCGCAGRev:TGGTTAGTTTCTTTTCCTCCGC95 ◦ C10min35cycles:94 ◦ C1min,53 ◦ C90s,   72 ◦ C   1min72 ◦ C10mintRNA-Thr/Cox1885Fw:   TGGAGAGTTTGGCGTCTTTTRev:CCATCTTCCACCTCATCTGG92 ◦ C2min38cycles:95 ◦ C30s,   65 ◦ C30s,72 ◦ C90s72 ◦ C10minExoTsaptreatment0.5   Uexonuclease1&   0.1UTSAPper20  lPCRproduct37 ◦ C15   min80 ◦ C15   min10 ◦ C30min  Pleasecitethisarticleinpressas:Zintl,A.,etal.,BovineparamphistomesinIreland.Vet.Parasitol.(2014),http://dx.doi.org/10.1016/j.vetpar.2014.05.024 ARTICLE IN PRESS G Model VETPAR-7260;No.ofPages104    A.Zintletal./VeterinaryParasitologyxxx(2014)xxx–xxx Fig.1. Percentageof    faecaldiagnosticUCDVHsubmissionsthatwerepos-itiveforparamphistomeeggsbetween2004and2013.Bluebarsindicatebovine( n =667),redbarsovinesamples( n =272).Figuresunderthe  x -axisindicatethenumberofcattleandsheepfaecalsamplesexaminedeach   year. 3.Results  3.1.HistoricalincidenceofparamphistomesaccordingtoUCDVHrecords Between2004and2013,theoverallnumberofdiag-nosticbovinesamplesthatwereassessedforthepresenceofparamphistomeeggsbysedimentationwas667.Labo-ratoryrecordsshowthatfromabout2009,thepercentageofpositivesamplesstartedtoincreasefroma   baselineof approx.3–9%toaround20%withpeaksin2010(32%)and2013(28%)(Fig.1).Insheepsamples,theincreasedpreva-lencefrom2009wasevenmorepronounced,however,theoverallnumberof    ovinefaecalsamplesexamined( n   =272)duringtheperiodwasmuchlower.  3.2.Prevalenceandintensityofrumenflukeinfectionsinthreecattleherds HerdA,Kildare:Onthefirstsamplingoccasion,32%of animalsinherdAwerefoundtoshedparamphistomeeggs.Bythe5thsamplingoccasion,8weekslater,prevalencehadincreasedtoalmost62%(Fig.2a).Generally,numbersof    epgfaeceswerelow(thehighestcountofapprox.13epg,wasrecordedonthelastsamplingoccasion),withnosampleexceedingthelimitforcategory+.HerdB,Wexford:Thepercentageofpositivesamplesincreasedgraduallyfrom15%inthefirstsampleto57%intheMay   andJulysamples(Fig.2b).Inautumn,prevalencestartedtodropoffagainandreachedabout42%byJanuaryofthefollowingyear.Thepeakin   prevalencewasmirroredbyintensitiesof    infectionwith28%of    faecalsamplesincat-egory+++(>50epg)recordedinJuly.Onthisoccasion10%ofsamplescontainedover200epg.Animalsthatremainednegativethroughoutbelongedtoasingleagecohortofbullsthatweregrazedseparately.HerdC,Tipperary:As   inherdBprevalenceandinten-sityincreasedsteadilyfromthefirstsamplingoccasioninNovember2012(60%ofsamplespositive,10%incategory+++)toJuly/Septemberwhenallanimalsweresheddingparamphistomeeggsand70%of    faecalsamplescontainedinexcessof50epg(category+++)(Fig.2c).Infact,in    July,over200epgwerecountedin32.5%of    samples.Againduringlateautumnandwinter,eggnumbersdeclined,however,allanimalscontinuedto   shedrumenflukeeggs.  3.3.Morphometricandmolecularaspectsofrumenflukeisolates Rumenflukescollectedfromslaughteredanimalsvariedconsiderablyin   size,rangingfrom6to68mg   (Fig.3).Para-sitesfromcattleinherdsAandBweresignificantlylarger(mean42.6mg   ± 8.3s.d.and44.7mg   ± 13.0s.d.,respec-tively)thanthosefrom‘other’cattle(mean28.7mg ± 12.8s.d.)(One-wayANOVA,  p <   0.0001,df2;f:33.37).Amplificationof    theITS-2regionyieldedidenticalprod-uctsin   allisolates,matchingthepublished C.   daubneyi sequence(AY790883)100%.Incontrast,therewas   a   con-siderabledegreeofheterogeneityintheamplifiedregionof    mitochondrialDNAamongstourisolates(greatestdis-crepancywas   2.35%)aswellasincomparisonwiththepublishedsequence,JQ815200(upto2.21%).Overall16differenthaplotypeswereidentifiedwhichhada   leptokur-ticdistribution,i.e.therewas   a   relativelysmallnumberof    verycommonhaplotypes.Eightisolateswererecordedonlyonce(Fig.4a).Thegreatestvarietyof    haplotypeswasrecordedforherdA( n =11),followedbyB( n =8)   and‘othercattle’( n =   6).Inaddition,‘infrequent’and‘rarehaplotypes’weremostcommonlyidentifiedinherdA,andleastoftenin‘othercattle’(Fig.4b).Phylogeneticanalysisindicatedthreemaincladeswithbootstrapsupportover50%(Fig.5).Thehaplotypesthat   weremostsimilarto    JQ815200wereIE1,themostcommonlyidentifiedhaplotypein   thisstudy,andIE12whichwasonlyamplifiedonce.Infact,sequence JQ815200contains3R’sindicatingpositionseitheroccu-piedbybasesAorG.Withthistakenintoaccount,IE1onlydifferedbytwo   singlebasedeletions,andIE12byanadditionalsinglenucleotidepolymorphism(SNP)from JQ815200.Therewas   noobviousclusteringof    haplotypesinindividualhostsor   herds.  3.4.PhylogeneticrelationshipofbovineparamphistomescollectedthroughouttheislandofIreland Analysisof    isolatesfromNorthernIrelandyieldedanadditionaltwohaplotypesthathadnotbeendetectedinHerdsA,Bor‘othercattle’.TheMedianJoiningNet-workconstructedfromatotalof    97isolates,showstheinterrelationships,frequencyanddiversityof    allhaplo-typesrecordedthroughouttheisland(Fig.6).Followingtrimmingof    allsequencestothesamelength,a   SNPthatdifferentiatedtwo   haplotypes(IE9andIE10)was   lost.Asa   resultsequenceswiththesetwohaplotypeswerecombinedwithIE7andIE8,respectively.Againtherewasnoobviousclusteringbyregion,withfiveoutof    eightcommonandinfrequenthaplotypesfromtheRepublicalsorecordedinNorthernIreland.Withoneexception(IE16),noneof    the‘rare’haplotypes(IE9–15)weredetectedinNorthernIreland.Overallthenetworkhada   linearratherthanstar-likeappearance.Regardinggeneticdiversity,thenorthernandthesouthernparamphistomepopulations  Pleasecitethisarticlein   pressas:Zintl,A.,etal.,   Bovineparamphistomesin   Ireland.Vet.Parasitol.(2014),http://dx.doi.org/10.1016/j.vetpar.2014.05.024 ARTICLE IN PRESS G Model VETPAR-7260;No.of    Pages10  A.Zintletal./    VeterinaryParasitologyxxx(2014)xxx–xxx 5 Fig.2. FaecaleggcountsinherdsA(a),B(b)andC(c).Thefiguresshowthepercentagesof    faecalsamplescategorisedas0,+   (<100eggscounted,equivalentto   approx.20epg),++(100–250eggscountedor20–50epg)and+++(>250eggscounted,i.e.inexcessof    50epgfaeces).
Search
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x