Food & Beverages

Bovine tryptases

Description
A complementary DNA encoding a new bovine tryptase isoform (here named BLT) was cloned and sequenced from lung tissue. Analysis of sequence indicates the presence of a 26-amino acid prepro-sequence and a 245 amino acid catalytic domain. It contains
Published
of 11
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform Alessandra Gambacurta 1 *, Laura Fiorucci 1 *, Paolo Basili 1 , Fulvio Erba 1 , Angela Amoresano 2 and Franca Ascoli 1 1 Department of Experimental Medicine and Biochemical Sciences, University of Rome ‘Tor Vergata’, Rome; 2 Department of Organic Chemistry and Biochemistry, University of Naples ‘Federico II’, Naples, Italy A complementary DNA encoding a new bovine tryptaseisoform (here named BLT) was cloned and sequencedfrom lung tissue. Analysis of sequence indicates the pres-ence of a 26-amino acid prepro-sequence and a 245 aminoacid catalytic domain. It contains six different residueswhen compared with the previously characterized tryptasefrom bovine liver capsule (BLCT), with the most signifi-cant difference residing at the primary specificity S1pocket. In BLT, the canonical residues Asp-Ser are pres-ent at positions 188–189, while in BLCT these positionsare occupied by residues Asn-Phe. This finding was con-firmed by mass fingerprinting of the peptide mixtureobtained upon in-gel tryptic digestion of BLT. Analysis bygel filtration of the purified protein shows that BLT isprobably tetrameric, similar to the previously identifiedtryptases from other species, with monomer migrating as35–40 kDa multiple bands in SDS/PAGE. As expected,the catalytic abilities of the two bovine tryptases are dif-ferent. The specificity constant values ( k cat / K  m ) assayedwith model substrates are 10- to 60-fold higher in the caseof BLT. The tissue-specific expression of the two tryptaseswas evaluated at the RNA level by analysis of their dif-ferent restriction patterns. In lung, only BLT was found tobe expressed, while in liver capsule only BLCT is present.Both isoforms are distributed in similar amounts in heartand spleen. Analysis of the two gene sequences reveals thepresence of several recognition sequences in the promoterregions and suggest a role for hormones in governing themechanism of tissue expression of bovine tryptases. Keywords : bovine tryptases; aprotinin; tissue expression;promoter sequences; mass spectrometry.Tryptases are trypsin-like proteinases stored in the secretorygranules of human [1–3], dog [4,5], rat [6–8], mouse [9,10],bovine [11], gerbil [12] and sheep [13] mast cells. Theseenzymes are released along with other mediators into theextracellular medium upon mast cell activation/degranula-tion. Although their patho-physiological role is not yetunderstood, tryptases seem to be involved in several mastcell-mediated allergic and inflammatory diseases. However,the underlying molecular mechanism, as well as theproenzyme/polypeptide target(s) of these enzymes havenot been identified yet, in spite of their involvement in avariety of biochemical reactions  in vitro  [14–18]. Recently itwas shown that human tryptase activates by proteolyticcleavage the proteinase-activated receptor 2, inducingwidespread inflammation by an unknown mechanism andpossiblycontributingtotheproinflammatoryeffectsofmastcells in human diseases [19].Almost all tryptases are made of glycosylated 245 residueidenticalsubunits,whichsharemanycharacteristicswiththeprototype enzyme trypsin (225 residues), in terms of sequence (identity around 45%) and overall folding. How-ever, two main features are peculiar to tryptases. Onefeature is the tetrameric structure of most tryptases studiedso far, which is necessary for biological activity and ismaintained  in vivo  through association with heparin; inmany cases this glycosaminoglycan is required for stabi-lizationoftheenzymeafteritsreleasefrommastcells[20,21].In the 3 A ˚crystal structure of the tetrameric  b II humanenzyme (molecular mass 120–140 kDa), the active site of each monomer faces a central oval pore, whose dimensionlimits the accessibility for macromolecular substrates/inhi-bitors [22]. A second common feature of tryptases seems tobe their occurrence as a multigene family: in humans, atleast four homologous tryptase cDNAs (tryptases  a  and b I–III) have been isolated [23–25] and a gene cluster was Correspondence to  Franca Ascoli, Department of ExperimentalMedicine and Biochemical Sciences, University of Rome  Tor Vergata  , Via Montpellier 1, 00133 Rome, Italy.Fax: + 39 06 72596477; Tel.: + 39 06 72596474;E-mail: ascoli@uniroma2.it Abbreviations : BLCT, bovine liver capsule tryptase; BLT, bovine lungtryptase; Boc,  t -butyloxycarbonyl; BPTI, bovine pancreatic trypsininhibitor; DFP, diisopropylfluoro-phosphate; MCA, methyl-coumarin; MUGB, 4-methylumbelliferyl  p -guanidinobenzoate;STI, soybean trypsin inhibitor; Z, benzyloxycarbonyl. Dedication : This paper is dedicated to the memory of Eraldo Antonini,eminent biochemist, prematurely deceased twenty years ago,on March 19th 1983. Note : nucleotide sequence data are available in the GenBank databasewith the accession numbers AF515641 (full-length bovine lungtryptase cDNA), X94982 (full-length bovine liver capsule tryptasecDNA), AF515642 (bovine lung tryptase promoter) and AF516175(bovine liver capsule tryptase promoter).*These authors contributed equally to this work.(Received 8 October 2002, revised 20 November 2002,accepted 29 November 2002) Eur. J. Biochem.  270 , 507–517 (2003)    FEBS 2003 doi:10.1046/j.1432-1033.2003.03406.x  identified for multiple human tryptases [26]; two tryptases(mMCP-6 and mMCP-7) have been identified in mouse[9,10], and their genes isolated [27,28].Inapreviouspaper[11],wereportedisolationofatryptaseisoform (BLCT) from bovine liver connective capsule(Glisson capsule). This enzyme is made of 245 amino acid(aa) subunits; its sequence was determined either biochemi-callyonthepurifiedproteinorbyisolatingandsequencingitscDNA [29]. The most peculiar and important differencebetweenBLCTandothertryptasesanalyzedsofaroccursatpositions188–189oftheprimaryspecificitypocketS1,wherethe basic side chain of the substrate P1 residue, Arg or Lys(whosecarbonylgroupbelongstothescissilepeptidebondof thesubstrate),isaccommodated.InBLCT,residuesAsn188and Phe189 replace the canonical residues Asp and Ser,respectively, present in all other tryptases and in all trypsin-like enzymes. However, these substitutions do not affectsignificantly the substrate specificity of the bovine enzyme.In this paper, we report cloning of a new cDNA frombovine lung encoding a tryptase isoform (BLT) with theusual doublet Asp-Ser in the S1 specificity pocket andisolationof thecorresponding protein.Sequenceanalysisbymass spectrometry and partial characterization of BLTrevealed more similarities between this enzyme and  b -typetryptases from other species with respect to BLCT. Someevidence on tissue-specific expression of the two isoforms indifferent bovine tissues is also reported and in this light thedifferent sequence of the two tryptase gene promoterregions are discussed. Experimental procedures Oligonucleotide primers and restriction enzymes PCR primers were obtained from MWG Biotech (Italy),Genset (France) or Pharmacia (Italy). Their numberingrefers to the first nucleotide (+1) of cDNA start codon.Restriction enzymes were obtained from New EnglandBiolabs (USA). Amplification reaction (PCR), cloning and sequenceanalysis Unless otherwise indicated, PCRs were conducted using5 U of   Taq  polymerase (Perkin Elmer, USA), 200 m M dNTPs, 1.5 m M  MgCl 2 , 10 m M  Tris/HCl, pH 8.3, 50 m M KCl (50  l L final volume) .  All PCR products were size-fractionated by agarose gel electrophoresis and the bandseluted, purified and subcloned in the PCRII TM TOPOvector containing the  lac  promoter and the  b -galactosidasegene, using the TA Cloning Kit (Invitrogen, USA).Transformation was performed in the TOP 10 cells, thepositive clones were isolated and their nucleotide sequencedetermined. Sequence analysis was performed on bothstrands by the dideoxy-chain termination method, eitherusing the Sequenase 2.0 Kit (Amersham Pharmacia BiotechItalia) or automatically. cDNA synthesis mRNA was prepared from various bovine tissues using theFast Track kit (Invitrogen, USA). The first strand cDNAwas synthesized at 42   C using 0.1–1  l g of mRNA with thecDNA cycle kit (Invitrogen). To obtain partial cDNAsencoding tryptases (see Results) PCRs were performed asalready described [29], using 2  l L of the RT reactionproducts and the primer pair N9 (nt 127–153, 5 ¢ -AGCCTGAGAGTCAGCCGTCGGTACTGG-3 ¢ ) and N10(nt 790–816 antisense, 5 ¢ -TCAGGGCCCCTGGGGGACGTACTGGTG-3 ¢ ). Entire tryptase cDNAs were obtainedunder the same conditions, at the annealing temperature of 58   C, using the primer pair Met (nt 1–20, 5 ¢ -ATGCTCCATCTGCTGGCGCT-3 ¢ , designed on the basis of the 5 ¢  RACE experiments reported below) and Coda[5 ¢ -CGCGCGCG(T) 16 ) 3 ¢ ] [29] and sequenced. 5 ¢  Rapid amplification of cDNA ends (RACE) 5 ¢  RACE was carried out to determine the 5 ¢  nucleotidesequence of the tryptase full-length transcripts, using theRACE System from Gibco (Paisley, USA). One hundrednanograms of bovine lung and hepatic capsule mRNAswere reverse transcribed using oligo-dT as primer. AfterpurificationofthefirststrandcDNA,adCtailwasaddedtothe 3 ¢  end using dCTP and terminal transferase. PCRswere conducted on 5  l L of the   tailing reaction  , using the5 ¢  RACE abridged universal amplification primerAUAP with a 3 ¢ -G tail (5 ¢ -GGCCACGCGTCGACTAGTACGGGGGGGGGGGGGG-3 ¢ ) as 5 ¢  primer and C1(nt 537–563 antisense, 5 ¢ -TACTTCCTGTCACAGACACTGTTCTCC-3 ¢ ) as 3 ¢  primer. Nested PCRs were thenperformed using the same 5 ¢  primer and C2 (nt 372– 396 antisense, 5 ¢ -GTGCCAGGAGATATTCACAAGCTTG-3 ¢ ) as 3 ¢  primer. Amplification reactions were con-ducted using 40 pmol of each primer, under the followingconditions: 2 min at 94   C (1 cycle), 1 min at 94   C, 1 minat 58   C, 1 min at 72   C (30 cycles) and 10 min at 72   C(1 cycle). Evaluation of tissue distribution of bovine tryptases In order to ascertain the expression of one or both tryptaseisoforms (see Results) in different bovine tissues, tryptasecDNAs were prepared as described above from mRNAsisolated from bovine liver capsule, lung, heart and spleen.The amplificationprofile wasoptimizedasfollows:1 min at94   C (1 cycle), 1 min at 94   C, 1 min at 58   C, 2 min at72   C (30–40 cycles) and 10 min at 72   C (1 cycle). TheRT-PCR products were separated by electrophoresisthrough a 1.5% (w/v) agarose gel, eluted, cloned in a TAvector and transformed in the TOP 10 competent cells. Thepositive clones were identified by restriction analysis with Nsp I (overnight at 37   C) and sequenced. Identification of 5 ¢  flanking sequences and UTRsof bovine tryptase genes A strategy similar to that described in the protocol of theUniversal Genome Walker Kit (CLONTECH, USA) wasemployed to identify 5 ¢  flanking sequences and UTRs of the tryptase genes.Genomic DNA was obtained from bovine liver using theDNA TURBOGEN Kit (Invitrogen, USA) at a finalconcentration of 100 ng Æ l L ) 1 and the molecular weight was 508 A. Gambacurta  et al.  ( Eur. J. Biochem. 270 )    FEBS 2003  checkedby0.8%(w/v)agarosegelelectrophoresis.GenomicDNA (500 ng) was then digested with 10 U of therestriction enzymes  Hinc II,  Eco RV,  Msc I,  Ssp I, in fourseparate reactions. Each digested sample was ligated withthe annealed adaptor oligonucleotides A1 (5 ¢ -GTAATACGACTCACTATAGGGCACGCGTGGTCGAC-3 ¢ ) andA2 (5 ¢ -GTCGACCACGCGTGC-3 ¢ , complementary to15 nt of the A1 3 ¢  region).Amplification reactions were then conducted for eachdigested and ligated genomic DNA sample (10  l L), using20 pmoles of each primer (see below) and 5 U of the  Elongaseenzymemix  (Gibco)in60 m M TrissulfatepH 9.1,18 m M  ammonium sulfate, 1 m M  magnesium sulfate and1.5 m M  magnesium chloride, in a final reaction volume of 50  l L. The conditions used were: 1 min at 94   C (1 cycle),1 min at 94   C, 1 min at 55   C (5 ¢  region) or at 52   C (3 ¢ region), 4 min at 68   C (32 cycles) and 5 min at 68   C (1cycle). Two microliters of each PCR was then used as atemplate in a nested PCR under the same conditions. Thefollowing oligonucleotides were used as primers: AP1 (5 ¢ -GTAATACGACTCACTATAGGGC-3 ¢ ,identicalto22 ntoftheA15 ¢ region);AP2(5 ¢ -ACTATAGGGCACGCGTGGT-3 ¢ , identical to 12 internal nt of A1); C3 (nt 41–61antisense, 5 ¢ -CCTGGCCAGGGGCTGCG GAGA-3 ¢ ); C4(nt 34–54 antisense, 5 ¢ -AGGGGCTGCGGAGACCAGGCT-3 ¢ ). The primer pairs AP1/C3 and AP2/C4 were used inthe first and in the nested PCR, respectively.Inordertoassignthetwo5 ¢ sequencesobtained(fromthegenomic DNA sample digested with  Hinc II, see Results) tothe two bovine tryptase genes, two different PCRs wereconducted, using as a template genomic DNA and theprimer pairs U1a/N10 and U1b/N10, respectively. PrimersU1a (5 ¢ -AGATGAAGGAATTAGTAGTTTAATGG-3 ¢ ,nt  ) 374 to  ) 399) and U1b (5 ¢ -ATTAATTTCAGTTTAAAAGAGCTACT-3 ¢ , nt ) 374 to ) 399) were designed onthe basis of the 5 ¢  sequences obtained (a and b). N10sequence is reported above. Amplification was conductedusing 20 pmol of each primer and 100 ng digenomic DNA,with the following parameters: 1 min at 94   C (1 cycle);1 min a 94   C; 1 min at 64   C; 4 min at 72   C (32 cycles);5 min at 72   C (1 cycle). The PCR products were size-fractionated by electrophoresis through a 1% (w/v) agarosegel. After cloning, the PCR II TM TOPO vectors, containingtheinserts,weredigestedwiththerestrictionenzyme Nsp Itodistinguish between the sequences encoding the two differ-ent bovine tryptases (see Results). Organization of bovine tryptase genes and locationof intron II–V Intron II–V length of the two genes encoding bovinetryptases was evaluated by amplification of bovine genomicDNA, using the following primer pairs: Met/C7 for intronII amplification; N9/C6 for intron III amplification;C8/C1 for intron IV amplification; C5/N10 for intron Vamplification. Sequences of primers Met, C1, N9 andN10 are reported above. Other primers used are: C5,5 ¢ -CCGTCGTGGAGAACAGTGTC-3 ¢  (nt 530–549); C6,5 ¢ -TGTCCGCCCCGTTCTTAACGCTGTA-3 ¢  (nt 328– 352, antisense); C7, 5 ¢ -ACGATGCCCGCGCGCTG-3 ¢ (nt 67–83, antisense); C8, 5 ¢ -ACGGGCTGGGGCAACGTGG-3 ¢  (nt 460–478). The primer pair sequencescorrespond to cDNA sequences at the intron/exon junctions, deduced from the homologous sequences of human and murine tryptase genes. PCRs were conductedusing 100 ng of genomic DNA as a template, 20 pmol of each primer, and the following conditions for amplification:3 min at 94   C (1 cycle), 1 min at 94   C; 1 min at theannealing temperature; 30 s at 72   C (30 cycles); 5 min at72   C (1 cycle). Annealing temperatures were: 58   C foramplification of introns II and III, 60   C for intron IV and62   C for intron V. The PCR products were size-fraction-ated by electrophoresis through a 1% (w/v) agarose gel,eluted, cloned in the PCR II TM TOPO vectors andsequenced. Purification of bovine tryptases BLCT and BLT were purified as previously described forbovine liver capsule tryptase [11], except that, in the case of the lung enzyme, the three step procedure (high-saltextraction followed by hydrophobic chromatography onoctyl sepharose and then an heparin affinity column) wascarried out using pH 5.5 buffers. Tryptase enzymaticactivity was routinely assayed at 30   C monitoring thefluorescence of 7-amino-4-methyl-coumarin released fromBoc-Phe-Ser-Arg-MCA substrate (Sigma Chemical Co.,USA), as reported previously [11]. The tryptase-containingfractions eluted fromtheheparincolumn wereconcentratedwith an Amicon stirred-cell concentrator equipped with a30 kDa cut-off membrane and stored at  ) 20   C in theheparin column elution buffer containing 20% (v/v)glycerol. Lung tryptase was purified further by gel filtrationchromatography. The enzyme sample was diluted with fourvolumes of 10 m M  Mes pH 5.5 and injected (100  l L) at a50  l L Æ mL ) 1 flow rate onto a Superose 12PC column(Pharmacia, Italy) pre-equilibrated with the gel filtrationbuffer (10 m M  Mes, 0.4  M  NaCl, pH 5.5). Protein wasdetected spectrophotometrically at 280 nm and 100  l Lfractions were collected. Tryptase activity in each fractionwas measured as described previously. The fractionscontaining tryptase activity were pooled and used forcharacterization of the enzyme. For determination of BLTmolecular weight, the three most active fractions werepooled, preincubated with heparin (10  l g Æ mL ) 1 , 10 min atroom temperature), and reloaded (20  l L) on the gelfiltration column as above.Tryptase concentrations were determined by active sitetitration with 4-methylumbelliferyl  p -guanidinobenzoate(MUGB) (Sigma Chemical Co., USA) for the lung enzymeas reported in [30], and with radioactive diisopropylfluoro-phosphate ([ 3 H]DFP) (New England Nuclear, UK) for theliver capsule enzyme, as already described [11]. Westernblotting was performed as already reported using an anti-(178/191-tryptase-peptide) Ig [31]. Mass spectrometry analysis Mass spectrometric analysis was performed on the Coo-massie blue-stained BLT protein excised from a preparativeSDS electrophoresis on a 14% (w/v) polyacrylamide gel.Theexcisedbandwaswashedfirstwithacetonitrileandthenwith 0.1  M  ammonium bicarbonate. Protein samples werereduced by incubation in 10 m M  dithiothreitol for 45 min at   FEBS 2003 Tissue-specific expression of bovine tryptases ( Eur. J. Biochem. 270 ) 509  56   C. The gel particles were then washed with ammoniumbicarbonate and acetonitrile. Enzymatic digestion wascarried out with trypsin (Sigma Chemical Co., USA) at afinal concentration of 15 ng Æ mL ) 1 in 50 m M  ammoniumbicarbonatepH 8.5,at4   Cfor4 h.Thebuffersolutionwasthen removed and a new aliquot of the enzyme/buffersolution was added for 18 h at 37   C. A minimum reactionvolume, sufficient for complete rehydration of the gel wasused. Peptides were then extracted washing the gel particleswith 20 m M  ammonium bicarbonate and 0.1% (v/v)trifluoroacetic acid in 50% (v/v) acetonitrile at roomtemperature and then lyophilized.MALDI mass spectra were recorded using a AppliedBiosystem Voyager DE-Pro reflector instrument. A mixtureof analyte solution and  a -cyanohydroxycinnamic acid[10 mg Æ mL ) 1 in acetonitrile/ethyl alcohol/0.1% trifluoro-acetic acid (1 : 1 : 1 v/v/v)] was applied to the metallicsampleplateanddriedundervacuum.Masscalibrationwasperformed using external standards. Raw data wereanalyzed using computer software provided by the manu-facturer and reported as monoisotopic masses. Enzymatic assays Rate assays for the determination of kinetic constants with7-amino-4-methyl-coumarin (MCA) peptide substrates(Sigma Chemical Co., USA) were started by addition of the enzyme (BLT or BLCT) to 0.1  M  Tris/HCl, pH 8.0,containing the various substrates in a total reaction volumeof 2.0 mL maintained at 25   C during measurements.Hydrolysis of MCA substrates was monitored using anexcitation wavelength of 370 nm and an emission wave-length of 460 nm in a Kontron spectrofluorimeter.  k cat / K  m valuesweredeterminedunderpseudofirst-orderconditions.Forallsubstrates[S  ]was  K  m .Progresscurveswerefittedusing an exponential function to obtain  k obs ;  k obs /[E] wasused to obtain  k cat / K  m , where [E] represents the enzymeconcentration.TotestforsusceptibilityofBLTtoinhibition,theenzyme(5 n M  active sites) and various inhibitors were mixed in2 mL of the assay buffer and maintained at 30   C for30 min. Then 20  l L of 1.5 m M  Boc-Phe-Ser-Arg-MCAwere added and residual activity was determined asdescribed above by comparison with that of an identicalenzyme incubation mixture containing no inhibitor. Results Cloning and sequence analysis of full-length tryptasecDNAs A partial cDNA (690 bp) encoding a new bovine tryptaseisoform (BLT) was obtained from lung mRNA byRT-PCR, using primers N9 and N10, and by subsequentcloning and sequencing. Based on this partial sequence, 5 ¢ RACE experiments and RT-PCR (using the primer pairMet and Coda) were performed as described in theExperimental Procedures. The full-length BLT cDNAconsists of 1078 bp, including the 5 ¢  untranslated 20 nt.ItssequenceisreportedinFig. 1A,withthededucedproteinsequence. An ATG codon is present 20 nt downstream of the 5 ¢ -end, the stop codon following after 813 nt. Thus, a271 residue protein precursor chain is encoded by a singleopen reading frame. The 242 bp 3 ¢ -UTR, with a polyade-nylation signal at nt 1039–1043, is identical in the initial100 bp to the 3 ¢ -UTR of BLCT cDNA [29], with an overalldifference in 71 positions.Full-length BLCT cDNA sequence of 1031 nt (Fig. 1B)was similarly obtained from liver capsule mRNA, by 5 ¢ RACE experiments and RT-PCR. The BLCT sequencepreviouslyreported[29]isnowconfirmedbythesequenceof the full-length BLCT cDNA, except for residue 11 of themature protein, in that it possesses Arg rather than Gln inthis position (see Fig. 2).When the deduced amino acid sequence of BLT iscompared withthatof BLCT andother tryptases (Fig. 2),itis evident that the first 26 aa residues of both bovineisoforms represent the prepro-sequence, the mature proteinstarting with residues IVGG, the canonical N-terminalsequence of tryptases. The serine protease catalytic triadresidues (His44, Asp91 and Ser194) and eight cysteineresidues building the predicted intrachain disulfide bondsare well conserved, as are many other sequence regions.Three putative N-linked glycosylation sites at positions 102(NIS), 171 (NVS) and 203 (NGT) are present in BLT,whereas only two glycosylation sites were found in BLCT[29],gerbiltryptase[12]andsheeptryptases1and2[13].Thesequence identity of BLT is about 98% with BLCT(corresponding to six different residues), 70–74% withtryptases from other species, except in the case of sheeptryptases 1 and 2 [13], where the identity reaches 82–83%.The major and more significant difference between BLTand BLCT resides at positions 188–189 of the S1 specificitypocket. In BLCT they are occupied by residues Asn-Phe(from full-length cDNA sequencing, in agreement withpreviously reported partial cDNA and protein sequencing[29]), while in BLT the canonical residues Asp-Ser arepresent, as in all tryptases from other species (see also belowfor the biochemical analysis of the purified protein). Tissue-distribution and expression patternof bovine tryptases Another interesting difference between the two bovinetryptase isoforms occurs at residue 179, which is Met inBLCT, as in many other tryptases, and is Asn in BLT (seeFig. 2), while residues 178 and 180 are identical in the twoenzymes. This results, only in BLCT cDNA, in a restrictionsite (ACATGT) for NspI endonuclease. Thus, when treatedwith this enzyme, BLT and BLCT cDNAs, cloned into theTA vector, show a different restriction pattern. BLT insertresults in an undigested band, while in the BLCT insert thepresence of the restriction site gives rise to two bands. Wetook advantage of this different restriction pattern withNspI to evaluate the distribution of bovine tryptases indifferent tissues (lung, heart, spleen and liver capsule). Theresults, reported in Fig. 3, show that in lung only BLT isexpressed, while in liver capsule only BLCT cDNA ispresent, in agreement with our previous results [29]. On thecontrary, in heart and spleen both isoforms are expressed.We were unable to detect BLCT mRNA in lung and BLTmRNA in the liver capsule, even when 40 cycles of PCRwere performed to allow identification of low abundanttranscripts. 510 A. Gambacurta  et al.  ( Eur. J. Biochem. 270 )    FEBS 2003  A   -20  AGCAGCCTGGACCTGCCAAG -1  ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC 72  M L H L L A L A L L L S L V S A A P G Q A L Q R (-3) GCGGGCATCGTCGGGGGGCAGGAGGCCCCTGGGAGCAGATGGCCCTGGCAGGTGAGCCTGAGAGTCAGCCGT 144  A G I V G G Q E A P G S R W P W Q V S L R V S R (22) CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216  R Y W R H H C G G S L I H P Q W V L T A A H C V (46)   • GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGTGAGCAGCACCTGTATTACCAGGACCAG 288  G P E V H G P S Y F R V Q L R E Q H L Y Y Q D Q (70) CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTACTACAGCGTTAAGAACGGTGCGGACATCGCCCTG 360  L L P I S R I I P H P N Y Y S V K N G A D I A L (94)   • CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCTGGTCACCCTGCCCCCTGAGTCGGAGACC 432  L E L D K L V N I S W H V Q L V T L P P E S E T (118)  *TTTCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504  F P P G T Q C W V T G W G N V D N G R R L P P P (142) TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576  F P L K Q V K V P V V E N S V C D R K Y H S G L (166) TCCACAGGGGACAACGTATCCATAGTGCAGGAGGATAACTTGTGTGCTGGGGACAGCGGGAGGGACTCCTGC 648  S T G D N V S I V Q E D N L C A G D S G R D S C (190)  *CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG 720  Q G D S G G P L V C K V N G T W L Q A G V V S W (214)   •  *GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792  G D G C A K P N R P G I Y T R V T S Y L D W I H (238) CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864  Q Y V P Q G P ♦   (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058 B   -20  AGCAGCCTGGACCTGCCAAG -1  ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC 72 GCGGGCATCGTCGGGGGGCAGGAGGCCCCTGGGAGCAGATGGCCCTGGCAGGTGAGCCTGAGAGTCAGCCGT 144 CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216 GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 360 CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 432 TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504 TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576 TCCACAGGGGACAACGTCCCCATCGTGCGGGAGGACATGCTGTGTGCTGGGGACAGCGGGAGGAACTTCTGC 648 CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG 720 GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864   ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc 936 ccacacctgatgaccccactcctggctgtacccctctcccgctcagctcacccccccgcaggggctgctgac 1008 actcattaaagagcatggagagg 1031 Fig. 1. Full-length bovine tryptase cDNAs.  Nucleotide numbering begins at the first nucleotide of the preprosequence. Stop codon ( r ) andpolyadenylation signal (underlined) are indicated. (A) BLT cDNA and deduced amino acid sequence. Potential N-linked glycosylation sites ( w ),residues of the serine protease catalytic triad ( d ) and residues identified by mass spectrometry (underlined) are indicated. Amino acid numberingstarts at the first residue of the mature protein. (B) BLCT cDNA (see also [29]).   FEBS 2003 Tissue-specific expression of bovine tryptases ( Eur. J. Biochem. 270 ) 511
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks