Documents

Characterization and Cloning of the Cry2A Gene From Indigenous Isolates of Bacillus Thuringiensis

Description
Description:
Categories
Published
of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  ISSN 00268933, Molecular Biology, 2015, Vol. 49, No. 4, pp. 520–526. © Pleiades Publishing, Inc., 2015.Published in Russian in Molekulyarnaya Biologiya, 2015, Vol. 49, No. 4, pp. 585–591. 520 INTRODUCTIONBt has been used as a successful biological insecticide for more than 40 years and is a uniquely specific,safe, and effective tool for the control of a wide variety of insect pests. Bt is a wellknown grampositive,sporeforming soil bacterium that forms parasporalinsecticidal crystal proteins during the stationary phase of its growth cycle. The crystals contain one or more Cry proteins ( δ endotoxins) that are specifically toxic to insect orders such as Lepidoptera, Diptera,and Coleoptera and also to some nematodes, mites,and protozoa [1–4]. However, there is a threat of eventual development of resistance in insects upon largescale cultivation of transgenic crops [5, 6]. Development of secondgeneration Bt transgenic cropsrequires new insecticidal genes for stacking or pyramiding wherein more than one insecticidal genes areused in combination as a resistance management strategy [7, 8]. Therefore, the isolation of novel Bt strainsand their characterization for insecticidal gene content may lead to the discovery of novel genes with ahigher toxicity which could provide an alternative tocope with the emergence of insect populations resistant to the currently deployed limited number of cry type gene (s).In order to identify novel cry  genes, Bt strains have been isolated worldwide from diverse habitats, including soil [9], stored grains [10], phyllospheres [11] andothers [12]. PCR is a useful technique for quick andsimultaneous screening of Bt strains for classificationand prediction of insecticidal activities. PCR together  with other methods of analysis such as RFLP, genesequence determination, electrophoretic, immunological and chromatographic analysis of Cry proteinsand insect bioassays for evaluation of toxicity have beenemployed for identification of new insecticidal proteins[13]. Currently more than 769 different cry  genes areknown and classified into 74 groups (Cry1–Cry74)[14]. Cloning of cry  genes provides an opportunity toexpress the cloned gene in acrystalliferous Bt or  Escherichia coli   to find out the insecticidal activities of the protein.In the present study the cry2A  gene(s) form indigenous isolated Bt starins were characterized, includingcrystal morphology observations, sodium dodecyl sulphatepolyacrylamide gel electrophoresis (SDSPAGE)and bioassays against lepidoteran insects and sequenceanalyses.EXPERIMENTAL  Bacterial strains and plasmids.  Two indigenous Btstrains (T30 and T48) and a reference strain, Bt (indigenous strain, 14r1) were obtained from the collectionof Bt strains from BtBiotechnology laboratory, Centre for Plant Molecular Biology and Biotechnology,Tamil Nadu Agricultural University, Coimbatore,India. The E. сoli   vector pTZ57R/T was obtained fromthe Fermentas INC. Characterization and Cloning of the cry2A Gene from Indigenous Isolates of Bacillus thuringiensis  1 R. Manikandan, A. Ramalakshmi, V. Balasubramani, and V. Udayasuriyan Centre for Plant Molecular Biology and Biotechnology, Tamil Nadu Agricultural University, Coimbatore641003, India;email: bioinba@gmail.com Received July 21, 2014; in final form, September 8, 2014  Abstract —Discovery of novel cry genes of Bacillus thuringiensis (Bt) with higher toxicity is important for thedevelopment of transgenic Bt crops resistant to target pests. Two new indigenous isolates of Bt were characterized for their colony type, crystal inclusion and toxicity with Helicoverpa armigera  Hubner and Spodopteralitura  Linn. Screening of cry2A  genes from the two new isolates of Bt, T30 and T48, by PCR with cry2A  family primers showed the presence of cry2A  genes only in the isolate T30. Further screening of these isolates of Bt with three different cry2A  gene specific primers showed the presence of cry2Aa , cry2Ab  and cry2Ac genes in both of the new Bt isolates. The cry2A  open reading frame (ORF) of Bt T48 (~1.9 kb) was amplified and clonedin a T/A vector (~2.8 kb). All the E. coli   transformants showed only the cry2Aa  gene. Comparison of thenucleotide sequence data generated from the cry2Aa  (~1.9 kb) gene showed a 99 percent homology and oneamino acid variation when compared with the holotype sequence of Cry2Aa1. DOI: 10.1134/S0026893315040111 Keywords : Bacillus thuringiensis , cry2A  gene, cloning and sequencing GENOMICS.TRANSCRIPTOMICS UDC 575:574.2 1   The article is published in the srcinal.  MOLECULAR BIOLOGY Vol. 49 No. 4 2015 CHARACTERIZATION AND CLONING OF THE cry2A  GENE 521 Characterization of indigenous isolates of Bt.  TheBt isolates were streaked on T3 agar plates and incu bated at 30 ° C  for two to three days. Colony morphology was observed on the single colonies developed onT3 agar plates. To analyze the crystal morphology, newisolates were grown in T3 media till 90% cell lyses,stained with 0.133% Coomassie brilliant blue G250 ina 50% acetic acid permanent staining solution andobserved for crystal morphology under a light microscope. The sporecrystal mixture was isolated from thetwo new isolates of Bt and a reference strain, HD1, asdescribed by Laemmli [15]. SDSPAGE was carriedout for the new isolates of Bt T30 and T48 using a nineper cent w/v acrylamide separating gel [15]. Toxicity analysis of the new isolates of Bt against Helicoverpaarmigera  and Spodoptera litura  was carried out asdescribed by Patel et al. [16].  Amplification of Bt DNA by PCR.  Total genomicDNA from the B. thuringiensis  strains T30 and T48 wasextracted as described earlier by Kalman et al. [17] andused as templates for the PCR screening. The genomicDNA of a reference strain of Bt, 14r1, was used as apositive control. A set of universal primers (BD2UF,BD2UR) was used to screen the Bt isolates for thepresence of the cry2A  family gene(s). These primersare expected to amplify the internal region specific tothe cry2A  family genes and the sub family gene screening was done by gene specific primers as described inBenDove et al. [18] (Table 1). The open readingframe (ORF) of Bt T48 was amplified by using a set of cloning primers (2AFS and 2ARS).PCR was accomplished using an Eppendorf thermal cycler in a 25 µ L reaction volume containing totalgenomic DNA of Bt (30 ng), 2.5 µ L of 10 ×  PCR buffer (10 mM TrisHCl; pH: 9.0, 50 mM KCl, 1.5 mM MgCl 2 ), 75   µ M each of dNTPs, 50 ng each of forwardand reverse primers and 0.5 Units of Taq  DNA polymerase. The PCR was performed for 30 cycles as follows: 94 ° C  for 1 min, 72 ° C  for 2 min and a final extension for 7 min at 72 ° C . The annealing temperature varied according to the gene as follows: cry2A , cry2Ab , cry2Ac  and cry2Ad  —0.45 min at 72 ° C . Where as for  cry2Aa  it was 62°C for 0.45 min. Cloning of cry2A  ORF from the indigenous isolate of Bt T48.  The primers 2AFS and 2ARS correspondingto the 5' and 3' end sequence of cry2A  orf were used toamplify the cry2A  gene of ~1.9 kb from the genomicDNA of Bt isolate T48. The gel eluted PCR productsof the cry2A  gene (~1.5 kb) from the Bt isolate T48 were ligated into the T/A vector (pTZ57R/T Fermentas INC) according to the manufacturer’s instruction.The ligated mixture was transformed into E. coli   by thestandard procedure [19]. The transformed colonies of  E. coli   were screened by colony PCR with gene specific primers to check the presence of the insert ( cry2A of Bt isolate T48). Nucleotide sequencing of recombinant plasmids. Plasmid DNA was isolated from the E. coli   transformants containing the ORF of the cry2A  gene of Bt isolate T48 and the nucleotide sequence of recombinantplasmids was determined by automated sequencing(Ist Base, Singapore). Sequence data was subjected tohomology search by a Basic Local Alignment SearchTool (BLAST) of the National Centre for Biotechnological Information (NCBI) [20]. The deduced aminoacid sequence was generated by the BioEdit software.RESULTS Characterization of Indigenous Isolates of Bt The new isolates of Bt were observed for colony morphology on T3 agar plates, the Bt isolate T30showed mucoid type and the T48 Bt isolate showedfried egg type colonies. Further, the crystal shapes of  Table 1. Primers used for screening cry2A  genesPrimer name Sequence  (5' →  3')  Amplicon size, bp BD2UFGTTATTCTTAATGCAGATGAATGGG cry2A internal region (~700) BD2URCGGATAAAATAATCTGGGAAATAGTBD2UFGTTATTCTTAATGCAGATGAATGGG cry2Aa internal region (~500) BD2ARGAGATTAGTCGCCCCTATGAGBD2UFGTTATTCTTAATGCAGATGAATGGG cry2Ab internal region (~550) BD2BRTGGCGTTAACAATGGGGGGAGAAATBD2UFGTTATTCTTAATGCAGATGAATGGG cry2Ac internal region (725) BD2CRGCGTTGCTAATAGTCCCAAACAACA BD2UFGTTATTCTTAATGCAGATGAATGGG cry2Ad   internal region (550) BD2DRTCACGTTGACAAAGGTGGCGA 2AFSATGGTACCATGAATAATGTATTGAATAGTGGAA  ~1900 of ORF  cry2A   2ARSGTTCTAGACTCAAACCTTAATAAAGTGGTG  522 MOLECULAR BIOLOGY Vol. 49 No. 4 2015 MANIKANDAN et al. new Bt isolates T30 showed bipyramidal and cuboidalshapes of inclusions and T48 only bipyramidal (Fig. 1).SDSPAGE analysis of the Bt protein from the newisolates of Bt T30 showed two prominent bands at 135and 65 kDa, whereas Bt isolate T48 showed only the135 kDa band (Fig. 2). Toxicity analysis was performed against neonate larvae of Helicoverpa armigera and Spodoptera litura  by the artificial diet based bioassay, and showed the new isolates of Bt T30 and T48 tohave 80 and 100 per cent mortality against Helicoverpaarmigera  and 60 and 80 percent mortality against Spodoptera litura  (Table 2). Screening of Bt Isolates for cry2A  Family Genesand Subfamily Genes Total genomic DNA isolated from indigenous isolates of Bt (T30 and T48) was equally diluted and usedas a template for detecting the presence of cry2A gene(s) by PCR using cry2A  family primers. Amplification of PCR products of an expected size (~700 bp) was observed from Bt isolate T30, whereas the Bt isolate T48 failed to give amplification. The new Bt isolates, T30 and T48, were further screened for sub family genes by gene specific primers (Table 3) and showedamplification for cry2Aa , cry2Ab , cry2Ac , but the intensity of amplification of cry2Ab  and cry2Ac  was much lessin Bt T48 than in the positive control (Fig. 3). Cloning and Sequence Analysis of ORF of cry2A  Gene from Bt Isolate, T48 Total genomic DNA isolated from the indigenousBt strain, T48 was used as template for amplificationof the cry2A  gene. The cry2A  ORF of ~1.9 kb wasamplified by PCR, using a set of forward (2AFS) andreverse (2ARS) primers. The forward (2AFS) andreverse primer (2ARS) have KpnI and XbaI restrictionsites at the 5' and 3' ends respectively. An intact band of ~1.9 kb was amplified by PCR, without any nonspecific amplification (Fig. 4a). The amplified PCR product of ~ 1.9 kb from the Bt strain T48 was columnpurified and ligated into the T/A vector (pTZ57R/T).The ligation mixture was used for the transformationof E. coli DH5 α  competent cells. The presence of aninsert in recombinant E. coli   colonies was confirmed by colony PCR with cry2Aa, cry2Ab  and cry2Ac  genespecific primers. Agarose gel electrophoresis of PCR products from transformants of E. coli   showed fragments of expected size (~500 bp) only in the case of the cry2Aa  gene primers (Fig. 4b). Plasmid DNA was (a)(b)(c)B— BipyramidalC—Cuboidal BC B— Bipyramidal B— BipyramidalC—Cuboidal C BB Fig. 1.  Light microscope photomicrographs of sporulated cultures of two local isolates of Bacillus thuringiensis.  a—Crystal shapefrom the reference Bt strain of kurstaki   HD1. b—Crystal shape from the new Bt isolate T30. c—Crystal shape from the new Btisolate T48. MHD1T30T48kDa20597684623kDa13565 Fig. 2.  SDSPAGE analysis of two indigenous isolates Bacillus thuringiensis.  M—molecular weight marker;HD1—reference Bt strain, T30 and T48, new isolates of Bt.  MOLECULAR BIOLOGY Vol. 49 No. 4 2015 CHARACTERIZATION AND CLONING OF THE cry2A  GENE 523 isolated from one of the PCR positive colonies (W1) of  E. coli   grown in LB broth containing ampicillin. Theplasmid was checked for the presence of insert DNA  with primers specific to the cry2Aa  gene. Agarose gelelectrophoresis of PCR products showed amplification of expected size (~ 500 bp). The recombinantplasmid from the clone W1 was named as pT2Aa. Therecombinant plasmid, pT2Aa on restriction digestion with XbaI and KpnI released fragments of expected sizes, viz., ~ 1.9 kb (insert) and ~ 2.8 kb (vector) (Fig. 4c).To determine the nucleotide sequence of the cry2Aa  gene cloned from the Bt strain T48, nucleotidesequencing of pT2Aa was carried out. The sequenceobtained with the M13F primer showed homology to48 bases of the pTZ57R/T vector, followed by 532bases of the 5' region of the cry2Aa1  ORF. Thesequence data obtained with the M13R primer showedhomology to 100 bases of the pTZ57R/T vector followed by 415 bases of the 3' region of the cry2Aa1  ORF.The Cry2Aa amino acid sequence of Bt strain T48deduced from the nucleotide sequence generated by M13F showed no variation from that of Cry2Aa. TheCry2Aa amino acid sequence of Bt strain T48 deducedfrom the nucleotide sequences generated by M13R showed a single amino acid variation from that of theCry2Aa holotype (Fig. 5).DISCUSSIONThe use of biopesticides, as a component of IPM,has been gaining acceptance around the world. Bt has been proven to be one of the best alternatives to chemical insecticides [2]. There is still a significant number of important agricultural insect pests that are not sensitive to the known Bt toxins [21]. Thus it is still essential to search for novel Bt strains that may lead to thediscovery of additional insecticidal proteins with ahigher toxicity against a wider pest range [3].Several screening projects of Bt collections fromdifferent parts of the world have been described [18,22–26, 13, 27, 28]. The strategies applied in these programs were based on the PCR method, which has become one of the most powerful approaches for identifying the cry  gene content, predicting insecticidalactivity, and detecting the presence of novel genes.Colony morphology can help to distinguish Bt colonies from other Bacillus  species. The study on colony morphology of nine isolates of Bt showed two types of colonies: that is, one typical, fried, and another mucoid type [29]. Initial identification of Bt is mainly  based on the presence of crystalline inclusions. Brightfield microscopy is more useful than phase contrastmicroscopy for high throughput evaluation of bacterial colonies for the presence of crystals and also for the identification of small crystals [30]. There is astriking correlation between the shape of the parasporal crystal and the spectrum of toxicity it displays; thelepidopterantoxic crystals are bipyramidal, dipterantoxic crystals are spherical, and coleopterantoxiccrystals are cuboidal in shape [31, 32]. The new Bt isolate T30 produced bipyramidal and cuboidal crystalsand T48 only bipyramidal ones. The protein profile of the new Bt isolate T30 showed two prominent bands,one of which with the size of 135 kDa correspondingto that of the Cry1 endotoxin, and another band withthe size around 65 kDa corresponding to the Cry2 protein, whereas the Bt isolate T48 showed mostly the135kDa protoxins and only a faint band of 65 kDa.Nowadays, bioassays using Bt isolates are preceded by molecular characterization, whose aim is to identify novel cry  genes that code proteins specific againstseveral insect species. Analysis of the in vivo bioassay of the new Bt isolates showed satisfactory results andreasonability of further molecular studies. In thisstudy, two new isolates of Bt were used to evaluate theefficacy of the Cry protein against lepidopteran insects( S. litura  and H. armigera ) and to compare with thereference strain, HD1 which was known to be highly toxic for the lepidopteran pests. Bioassay of the new Btisolates of T30 and T48 with H. armigera  showed amortality rate of 80 and 100 percent respectively, whereas against S. litura  the mortality rates of 60 and80% were recorded for T30 and T48 respectively.During PCR screening of the cry2A  family genes inthe two new isolates of Bt, the T30 isolate showed pos Table 2. Characterization of new isolates Bt T30 and T48Name of the Bt isolatesColony morphologyCrystal shapeToxicity, % H. armigeraS. litura T30MucoidBipyramidal and cuboidal8060T48Fried eggBipyramidal10080HD1Fried eggBipyramidal 100100 Table 3. Screening of new isolates of Bt by PCR for thepresence of cry2A  gene(s)Bt isolates cry2Acry2Aacry2Abcry2Ac T30++++++++T48–++ +14r1 (reference strain)++++++++ +, Positive; –, Negative.
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x