Calendars

EXPRESSION OF IGF1, IGF1R, AND SP1 FACTORS IN HPV INFECTED CERVICAL CANCER CELLS

Description
Bull Vet Inst Pulawy 55, , 2011 EXPRESSION OF IGF1, IGF1R, AND SP1 FACTORS IN HPV INFECTED CERVICAL CANCER CELLS MARIA MAGDALENA KOCZOROWSKA, ANNA KWAŚNIEWSKA 1, AND ANNA GOŹDZICKA-JÓZEFIAK Department
Categories
Published
of 6
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
Bull Vet Inst Pulawy 55, , 2011 EXPRESSION OF IGF1, IGF1R, AND SP1 FACTORS IN HPV INFECTED CERVICAL CANCER CELLS MARIA MAGDALENA KOCZOROWSKA, ANNA KWAŚNIEWSKA 1, AND ANNA GOŹDZICKA-JÓZEFIAK Department of Molecular Virology, Adam Mickiewicz University, Poznan, Poland 1 Department of Obstetrics and Gynecology, Medical University, Lublin, Poland Received: November 18, 2010 Accepted: April 1, 2011 Abstract The aim of the study was to investigate the mrna expression levels of IGF1, IGF1R, and SP1 in cervical epithelial cells in different stages of cervical cancerogenesis using real-time PCR. The analysis indicated up-regulation of IGF1 gene expression in L- SIL and H-SIL, followed by its down-regulation in cervical cancer. Firstly, the obtained results suggest that IGF1 can be recognised as an essential factor in cervical cancerogenesis; secondly the SP1 action may be crucial for IGF1 expression. Key words: IGF, IGF1R, SP1, cervical cancer, human papillomavirus. Human papillomavirus (HPV) is a nonenveloped epitheliotropic virus with double-stranded circular DNA. More than 100 types have been identified and the classification is based on the sequence of L1 open reading frame. With respect to the oncogenic properties, HPVs are recognised as low and high risk. Among the latter, types HPV 16 and 18 are the most oncogenic and thus cause the greatest number of cervical cancers (4). Interestingly, not all women infected with highly oncogenic HPV develop cancer and those infections regress without intervention within a short period of time. Therefore, it can be inferred that besides HPV infection, the host factors are also required to facilitate cervical cancerogenesis (13). Insulin-like growth factor 1 (IGF1), involved in a variety of cellular processes including cell proliferation, differentiation and apoptosis, is one of the putative factors, which may be implicated in cervical cancerogenesis. IGF1 is a 70-aminoacid protein and its expression has been detected in many tissue types. The circulatory fraction is synthesised in the liver and transported by IGF1-binding proteins with blood-stream to target tissues (endocrine activity). The local fraction is produced locally in the target tissue and reveals both paracrine and autocrine activity (8). IGF1 gene transcription is controlled by two promoters: P1 and P2, located upstream exon 1 and exon 2, respectively. IGF1 P1 promoter sequences are highly conserved in most species and consensus TATA- or CAAT-boxes are not present. SP1 is a sequence-specific ubiquitous transcription factor, which binds to the GCbox (12). This C2H2-type zinc finger-containing DNA binding protein can both activate and repress gene transcription in response to physiologic and pathological stimuli (21). The biological effects of IGF1 depend on the complex interplay between IGF1, IGF1 binding proteins, IGF1R, and IGF1 proteases in the cell. IGF1R is a type 2 tyrosine kinase receptor, synthesised as a single chain prepropeptide with a 30- aminoacid signal peptide, which undergoes photolytic cleavage. The mature cell membrane-bound IGF1R consists of two 130 to 135 kda α-chains and two 90 to 95 kda -chains with several α-α and α- disulfide bridges (7). The IGF1R is expressed in almost all human cell types and is important in controlling cellular proliferation. Activation of the IGF1R by its ligands (IGF1 and IGF2) within cytoplasmic domain of the receptor is followed by binding of various adapter molecules, which contribute to the specificity of downstream signalling. Therefore, IGF1R plays an important role in the establishment and maintenance of the transformed phenotype (1). In the presented study, the mrna expression of IGF1, IGF1R, and SP1 in cervical epithelium in normal and HPV-infected precancerous and cancerous tissues was investigated. 282 Material and Methods Research material. The study was performed in a group of 109 women, aged 23 to 61 (median of 49) years. Among them, 87 were treated for L-SIL (low grade squamous intraepithelial neoplasia), H-SIL (high grade squamous intraepithelial neoplasia), and squamous cell cervical carcinoma during The study was approved by The Ethical Committee of the Medical University in Lublin. For cancer and neoplasmatic cell localisation, all specimens initially underwent haematoxylin and eosin staining followed by pathologists reviewing. Cervical sections with cancer cells were used as cancer samples. After surgical removal, the tissue samples were frozen immediately in liquid nitrogen and stored at 80 C until further use. The study group consisted of 28 postoperative tissues from patients diagnosed with L-SIL, 30 postoperative tissues from patients diagnosed with H- SIL, and 29 tissues from squamous cell cervical carcinoma. The control group consisted of normal cervical tissue specimens obtained from 22 patients that underwent hysterectomy due to uterine leiomyomas. The histopathological criteria formulated by the WHO were used to establish the diagnosis of squamous cell cervical carcinoma (12). As far as the histopathological type is concerned, in the group of patients with squamous cell carcinoma, there were 15 cases of keratinising type and 14 cases of nonkeratinising types. With respect to dedifferentiation of neoplastic cells, the following groups of patients were distinguished: (G1 n=5, G2 n=14, G3 n=10), according to the WHO (grading). According to the degree of dedifferentiation of the neoplastic cells, the following groups of patients were distinguished: with well differentiated (G1) carcinomas (14 squamous cell carcinomas and one adenocarcinoma), with moderately differentiated (G2) carcinomas (10 squamous cell carcinomas), and with poorly differentiated (G3) (four squamous cell carcinomas). According to the FIGO clinical staging, amongst squamous cell cervical carcinoma tissues, 15 patients were classified as I, and 14 as IIA stage. There were no significant differences in the mean age of women, who underwent surgery due to squamous cell cervical carcinoma when compared to control women ( vs ). However, there was a statistically lower mean age of women with H-SIL when compared to women with squamous cell cervical carcinoma, and to control women (P 0.05) (Table 1). HPV identification. Genomic DNA was isolated from the examined tissues using QIAamp DNA Midi Kit (QIAGEN, Germany) according to the manufacturer s protocol. HPV infection was identified in PCR amplification of HPV gene sequence, using primers MY09 and MY11 complementary to genome sequence of at least 33 types of HPV viruses as described previously (13). The reaction mixture contained 15 ng/μl of DNA and the following reagents: 0.5 U Taq DNA polymerase (Fermentas, Germany), PCR buffer and magnesium chloride in the final concentration of 1.5 mm (Fermentas), primers in the final concentrations of 0.25 mm each, and dntps (Promega, U.S.A.) in the final concentration of 0.2 mm. PCR products were analysed in 1.2% agarose gel electrophoresis, stained with ethidium bromide and visualised in UV light. The product s length was assessed according to MassRuler DNA marker (Fermentas). PCR products were randomly eluted from agarose gel using QIAquick Gel Extraction Kit (QIAGEN) and sequenced to confirm expected product presence. The sequencing results were computationally analysed using BLAST database (14). RNA extraction and cdna synthesis. Total RNA was extracted using RNeasy-Fibrous Tissue Minikit (QIAGEN) according to the manufacturer s protocol. The RNA purification included double DNase treatment. RNA quantification was performed spectrophotometrically and the quality was assessed by agarose-formaldehyde gel electrophoresis. For each sample, after genomic DNA removal, 1 μg of RNA was converted into first-strand cdna in reverse transcription reaction using QuantiTect Reverse Transcription Kit (QIAGEN) following the manufacturer's instructions. Real-time PCR. All real-time PCR primers used in this study are presented in Table 2. Primers specific to human IGF1 gene were complement to the sequences in constitutive exons 3 and 4 (9). Primers for IGF1R were as described before (19). Primers for reference genes, GAPDH and RPLP0 were used as described previously (3). Quantitative real-time PCR analyses were performed in automated fluorometer (Rotor-Gene 6000, Corbett Research, Germany) using SYBR Green PCR master Mix (Applied Biosystems, UK). As reference genes, GAPDH and RPLP0 were used and the selection was based on data from previously described validation study (3). PCR was carried out in a final volume of 10 μl, containing 2 μl of cdna, primers in the concentration of 1μM each, and SYBR Green PCR master Mix. The samples were run in triplicates and placed in 72-well plate. The reaction was performed under the following conditions: initial denaturation at 90 C for 10 min, followed by 45 cycles of denaturation 95 C/10s, annealing (the temperature depended on the primers sequences - see Table 2) and elongation 72 C/20s. PCR products were quantified according to the standard curves produced by amplification of serial dilutions and the expected product was verified according to the melting point. Statistical analysis. The measured parameters were statistically evaluated as quotient scale by means of median, lower, and upper quartile with range of trait variability. Because of a skewed distribution of the analysed parameters evaluated by Shapiro-Wilk test, or non-homogeneous variance calculated by F-Fischer test, non-parametric tests were used to analyse differences between subgroups. Kruskal-Wallis test and multiple post-hoc analysis were used for comparison of more than two groups. 283 Table 1 Demographic characteristic in the studied and control groups Group n Mean ±SD Low grade squamous ±8.43 intraepithelial neoplasia L-SIL High grade squamous ±9.02 P 0.001*,** intraepithelial neoplasia H-SIL Squamous cell ±13.49 P 0.001***,a n.s. cervical cancer Control ±6.12 Total ±12.09 n-number of patients examined *- in relation to the squamous cell cervical carcinoma: value of the test function F=6.268, P=0.015; t=-5.453, P 0.001; **- in relation to control: value of the test function F=5.125, P=0.027; t=-7.669, P 0.001; *** - in relation to the H-SIL group: value of the test function F=19.746, P 0.001; t=0.380, P 0.001; a n.s. no statistical significance as compared to control group: value of the test function F=19.346, P=0.718, t=364, P=0.705; ±SD standard deviation. Applied gene SP1 IGF1R IGF1 RPLP0 GAPDH Table 2 Primers used for real-time PCR analysis Primer name Primer sequence Fragment lenght SP1-F1 SP1-R1 IGF1R-F IGF1R-R IGF1-F IGF1-R RPLP0-F RPLP0-R GAPDH-F GAPDH-R CCCAACCCCAAGCCGGTC CCCCCGAGCCCCTTCC GGGAATGGAGTGCTGTATG CACAGAAGCTTCGTTGAGAA GCTCTTCAGTTCGTGTGTGG TGACTTGGCAGGCTTGAGG CCTCATATCCGGGGGAATGTG GCAGCAGCTGGCACCTTATTG AAGGTCGGAGTCAACGGATTT ACCAGAGTTAAAAGCAGCCCTG Annealing temperatu re 85bp 65 C 258bp 60 C 171bp 60 C 95bp 56 C 60bp 58 C Levels of significance with 5% error (P 0.05) were chosen to calculate statistical significance of differences or correlations. The results obtained were presented in tables and graphs. All calculations were carried out using the Statistica 7.1 software package (StatSoft, Poland). Bioinformatical analysis. For bioinformatical prediction of transcription factor binding sites within the IGF1 P1 and P2 promoter regions the AliBaba2 programme was used (6). Results To determine whether normal precancerous cervical cancer cells express IGF1, IGF1R, and SP1, the mrna expression levels were quantified using real-time PCR. Our analysis showed up-regulation of IGF1 gene expression in L-SIL and H-SIL followed by its downregulation in cancer (Fig. 1A). The expression profile of IGF1R gene was similar to this of IGF1 in L-SIL and H- SIL; however, its expression level increased upon cervical cancerogenesis (Fig. 1B). Interestingly, SP1 expression level appeared to be diversified in each stage of cancerogenesis: its up-regulation in precancerous and cervical cancer cells was observed; however, the highest SP1 level was noted in L-SIL and cancer (Fig. 1C). This data was statistically significant at P 0.05 when compared to control. The bioinformatical analysis using AliBaba2 programme identified multiple SP1 binding sites in both P1 and P2 IGF1 promoter sequences. Discussion High levels of circulating IGF1 have been reported to be a risk factor for a number of cancers such as breast, prostate, and colorectal cancer, widely spread in human populations (25). 284 A B C IGF1expression [r.e.l.] IGF1R expression [r.e.l.] SP1 expression [r.e.l.] 1E control L-SIL H-SIL cervical cancer control L-SIL H-SIL cervical cancer control L-SIL H-SIL cervical cancer Median 25%-75% Median 25%-75% Median 25%-75% Fig. 1. The expression of IGF1 (A), IGF1R (B), and SP1 (C) in control, L-SIL, H-SIL, and cervical cancer tissue. The relative expression level has been assessed with respect to reporter genes GAPDH and RPLP0. Recent data suggest that IGF1 may facilitate cervical cancer development in several aspects. Despite the pro-proliferating activity of IGF1, it has been shown that IGF1 may stimulate cervical cancer invasiveness (20). Moreover, the connection of IGF1 functioning with HPV infection has been reported. Mannhardt et al. (15) showed that HPV E7 protein interacts with IGF1- binding protein and therefore inactivates it, which subsequently causes increased circulatory IGF1 action. Little is known about the local expression of IGF1 in tissue and its effect on cervical cancer development. Our analysis showed differential local expression of IGF1 gene in cervical epithelium. Interestingly, its upregulation in precancerous lesions and down-regulation in cancer was observed. In the presented study the down-regulation of IGF1 co-occurred with up-regulation of IGF1R. Given that IGF1R is the receptor, which mediates IGF1 action, this result appears to be interesting. Due to reduced IGF1 gene expression fewer IGF1 particles are produced. Therefore, smaller number of ligands is available for the IGF1R receptor in cervical epithelial cells. However, the putatively insufficient amount of IGF1 is compensated by larger number of IGF1Rs in cancer tissue. Thus, the receptor accessibility by the ligand is relatively bigger, which may result in a more efficient signal transduction via IGF1R. The distinct activity of IGF1 and IGF1R genes in cervical cancer cells can be explained firstly by the fact that we studied the locally expressed IGF1 while IGF1R is activated by both: local and circulatory IGF1 fractions (17), secondly not only IGF1 but also IGF2 and insulin have a considerable affinity to IGF1R (22). Immunohistochemical analysis showed higher IGF1R expression level in H-SIL and cancer cells when compared to normal cervical epithelial cells. Moreover, the distribution of IGF1R overexpression in L-SIL and H-SIL was co-localised with HPV E6 oncoprotein (10). The up-regulation of IGF1R gene was previously observed in several human cancers (2, 24). It has been suggested that increased expression of IGF1R in cancer cells may be caused by impaired transcriptional control by a number of tumour suppressor genes (23). The treatment with blocking antibody against IGF1R decreased its phosphorylation and therefore activation of downstream kinases, leading to tumour regression in SCID mouse model (14). It has been also reported that down-regulation of IGF1R by antisense RNA can reverse the transformed phenotype of human cancer cell lines (16). The autocrine overexpression of IGF1R may be an important component controlling proliferation of cervical carcinoma cells. It has been shown that neoplastic transformation and proliferation are promoted in cells that overexpress IGF1R, and IGF1R displays a very strong antiapoptotic activity by activating downstream cascades. High IGF1R mrna level has been detected in many tumours and cancer-derived cells, which can result from the impaired functioning of tumour suppressors, including p53. In HPV-positive cervical cancer cells the expression of viral E6 and E7 proteins deregulates host cell growth cycle by binding and inactivating tumour suppressor proteins p53, prb, cell cyclins, and cyclin-dependent kinases. It is postulated that decrease in p53 protein level due to HPV infection may contribute to up-regulation of IGF1R expression in cervical cancer cells. Therefore, IGF1R may be an attractive anti-cancer treatment target (18). 285 We also demonstrated a higher level of SP1 transcriptional factor mrna in HPV positive cervical cancer cells. Numerous studies indicated that IGF1 expression is regulated by SP1 factor. Our bioinformatical analysis showed putative SP1 binding sites on P1 and P2 promoters. Interestingly, it has been suggested that not only SP1 activates IGF1 gene but also the SP1 binding site is a target of IGF1 action on other genes activated in cancer (12). This finding can be a valuable justification for high SP1 expression in cancer. SP1-binding site was found in HPV E6/E7 promoter region. It is suggested that this is the only site in viral promoters regions recognised by cellular transcription factor, which is crucial for functioning of the early transcription start (5). Thus, we suggest that up-regulation of SP1 during the early stage of neoplasia may enhance the expression of HPV early oncogenic proteins E6 and E7. It is highly plausible that this action can be essential in cervical cancerogenesis. Recent studies on SP1 expression in HPV infected cells showed a coincident expression of SP1 and viral L1 protein in differentiating mouse keratinocytes, and therefore SP1 may also act as a cell differentiation marker in human and mouse differentiating keratinocytes (11). Acknowledgments: We acknowledge the assistance of Dr Agata Smoleń and Professor Maria Kaczmarek in statistical analysis. This work was supported by the Polish Ministry of Science and High Education. Grant No. N N References 1. Chitnis M.M., Yuen J.S., Protheroe A.S., Pollak M., Macaulay V.M.: The type 1 insulin-like growth factor receptor pathway. Clin Cancer Res 2008, 14, Chong Y.M., Colston K., Jiang W.G., Sharma A.K., Mokbel K.: The relationship between the insulin-like growth factor-1 system and the oestrogen metabolising enzymes in breast cancer tissue and its adjacent noncancerous tissue. Breast Cancer Res Treat 2006, 99, Daud I.I., Scott M.E.: Validation of reference genes in cervical cell samples from human papillomavirusinfected and uninfected women for quantitative reverse transcription-pcr assays. Clin Vaccine Immunol 2008, 15, Doorbar J.: Molecular biology of human papillomavirus infection and cervical cancer. Clin Sci (London) 2006, 110, Gloss B., Bernard H.U.: The E6/E7 promoter of human papillomavirus type 16 is activated in the absence of E2 proteins by a sequence-aberrant Sp1 distal element. J Virol 1990, 64, Grabe N.: AliBaba2: context specific identification of transcription factor binding sites. In Silico Biol 2002, 2, S1-S Hartog H., Wesseling J., Boezen H.M., van der Graaf W.T.: The insulin-like growth factor 1 receptor in cancer: old focus, new future. Eur J Cancer 2007, 43, Jones J.I., Clemmons D.R., Insulin-like growth factors and their binding proteins: biological actions. Endocrinol Rev 1995, 16, Jozefiak A., Pacholska-Bogalska J., Myga-Nowak M., Kedzia W., Kwasniewska A., Luczak M., Kedzia H., Gozdzicka-Jozefiak A.: Serum and tissue levels of insulin-like growth factor-i in women with dysplasia and HPV-positive cervical cancer. Mol Med Report 2008, 1, Kuramoto H., Hongo A., Liu Y., Ojima Y., Nahamura K., Seki N., Kodama J., Hiramatsu Y.: Immunohistochemical evaluation of insulin-like growth factor 1, receptor status in cervical cancer speciments. Acta Med Okayama 2008, 62, Li B., Wang X., Zhou F., Saunders N.A., Frazer I.H., Zhao K.N.: Up-regulated expression of Sp1 protein coincident with a viral protein in human and mouse differentiating keratinocytes may act as
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks