Others

Ku86 exists as both a full-length and a protease-sensitive natural variant in multiple myeloma cells

Description
Ku86 exists as both a full-length and a protease-sensitive natural variant in multiple myeloma cells
Categories
Published
of 13
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  BioMed   Central CTIONAL   INTERNACANCER CELL Page 1 of 13 (page number not for citation purposes) Cancer Cell International Open Access Primary research Ku86 exists as both a full-length and a protease-sensitive natural variant in multiple myeloma cells CharlesAGullo* 1,2 , FengGe 2 , GeralineCow  1,2  and GerrardTeoh 2,3  Address: 1 Department of Clinical Research (DCR), Cancer Immunology Laboratory, Singapore General Hospital (SGH), Outram Road, Singapore 169608, Singapore, 2 Multiple Myeloma Research Laboratory (MMRL), Singapore Health Services Pte Ltd (SingHealth), 7 Hospital Drive, Block A #02-05, Singapore 169611, Singapore and 3 Department of Hematology, SGH, Outram Road, Singapore 169608, SingaporeEmail: CharlesAGullo*-charles.gullo@sgh.com.sg; FengGe-frankge001@hotmail.com; GeralineCow-gcow@jjisg.jnj.com; GerrardTeoh-ghk_teoh@parkway.sg * Corresponding author Abstract Background: Truncated variants of Ku86 protein have previously been detected in 86% to 100%of freshly isolated patient multiple myeloma (MM) cells. Since, the Ku70/Ku86 heterodimerfunctions as the regulatory subunit of the DNA repair enzyme, DNA-dependent protein kinase, wehave been interested in the altered expression and function of Ku86 variant (Ku86v) proteins ingenome maintenance of MM. Results: Although, a number of studies have suggested that truncated forms of Ku proteins couldbe artificially generated by proteolytic degradation in vitro in human lymphocytes, we now showusing whole cell immunoblotting that the RPMI-8226 and SGH-MM5 human MM cell linesconsistently express full-length Ku86 as well as a 69-kDa Ku86v; a C-terminus truncated 69-kDavariant Ku86 protein. In contrast, Ku86v proteins were not detected in the freshly isolatedlymphocytes as was previously reported. Data also indicates that the Ku86v was not generated asa result of carbohydrate modification but that serine proteases may act on the full-length form of the protein. Conclusion: These data confirm that MM cells contain bona fide Ku86v proteins that weregenerated intracellularly by a post-transcriptional mechanism, which required proteolyticprocessing. Introduction Ku80 and Ku70 are two important related family mem-bers involved in the facilitation of DNA double strandbreak repair (DSBR) in association with the DNA repair enzyme, the catalytic subunit of DNA-dependent proteinkinase catalytic (DNA-PKcs), XRCC4, DNA ligase IV and ahost of other enzymes. Although present in most cells,Ku86 has been extensively studied in B and T cells due toits proposed role in the CD40-induced immunoglobulin(Ig) class switch recombination (CSR) and V(D)J lym-phocyte antigen recognition/recombination events, bothof which generate transient DNA double-strand breaks. The importance of this protein in lymphocyte develop-ment was most notable in Ku86 knockout mice, whichfailed to develop mature lymphocytes [1]. There has alsobeen a strong association with Ku-dependent DNA DSBR and/or protection from ionizing irradiation-induced DNA damage [2-6]. Besides its well known role in DNA repair, Published: 29 April 2008 Cancer Cell International   2008, 8 :4doi:10.1186/1475-2867-8-4Received: 16 November 2007Accepted: 29 April 2008This article is available from: http://www.cancerci.com/content/8/1/4© 2008 Gullo et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the srcinal work is properly cited.  Cancer Cell International   2008, 8 :4http://www.cancerci.com/content/8/1/4Page 2 of 13 (page number not for citation purposes) numerous reports have implicated Ku proteins in numer-ous other cellular processes, including the maintenance of telomere length, regulation of G2 and M phases of the cellcycle, regulation of apoptosis and specific gene transcrip-tion, and regulation of heat shock-induced responses[7,8].  Although Ku86 and Ku70 are predominantly localized tothe nucleus and the nuclear matrix, it has been found inother subcellular compartments including the cytoplasm[9] and cell membranes of numerous cell types [10,11].  The identification of Ku proteins in various compartmentsof the cell has led to the identification of putative novelfunctions of both Ku86 and Ku70. For example, in multi-ple myeloma (MM) cells, CD40-induced Ku86 surfaceexpression resulted in increased cellular adhesion tofibronectin and bone marrow stromal cells [12] Other reports indicate that Ku70/Ku86 is found in the cytoplasmduring mitosis and it returns to the nucleus as the cellenters the G1 phase of the cell cycle [13,14]. Finally, in colonic tumor cells, translocation of Ku86 from the cyto-plasm to the nucleus occurs via interactions with a growthinhibitory tetradecapeptide and thus, Ku86 acts as a puta-tive somatostatin receptor [15]. Therefore, location of Ku86 and other members of the DNA repair machinery in various compartments of mammalian cells may lead tonumerous downstream functional consequences. There have been a number of reports that indicate Ku86exists in two forms, an 86 kDa full-length form and a C-terminal truncated variant form of approximately 69-kDa,in B cells from the peripheral blood (PB) [16], the acutepromyelocytic leukemia (APL) cell line HL-60 [17], MMcells [5], as well as senescent fibroblasts [18]. It is unlikely  that the variant protein is a product of alternative splicing of the Ku86 full length transcripts since shorter mRNAshave not been found by northern blot analysis [16,17]. Consistent with these findings, a 69-kDa variant of Ku86 was also found in the mitochondria of mammalian cells[19]. Furthermore, in the above reports, the variant of Ku86 was still able to bind DNA and associate with Ku70consistent with the retention of the domains that are asso-ciated with those functions. Therefore, it is currently thought that variants of Ku86 are formed as a result of post-translational modification. It is the nature of thismodification, which has resulted in some controversialissues regarding the physiological existence of this variant.Several recent studies have suggested that the Ku86 variant seen in lymphocytes may be due to cleavage by proteasesinduced during biochemical isolation [20-22]. Consider- ing the increased amount of genomic instability seen inMM, the disregulated CD40/interleukin-4 (IL-4) pathway in MM cells [23], and the role of Ku in DNA DSBR andnon-homologous end-joining (NHEJ), we investigatedthe presence of Ku86 and its variants in MM cells, andcompared them to T lymphocytes and other cell lines. Wefound that unlike human T lymphocytes, the detection of 69-kDa Ku86 (Ku86v-N) variant is not likely due to invitro generated protease cleavage. Moreover, we demon-strate that the full-length, as well as the truncated form of Ku86 are found in the nucleus, membrane and cytosolic fractions of resting and CD40-stimulated MM cells.Finally, we show that intracellular protease inhibition canprevent the appearance of the Ku86 variant and that theprotease responsible is likely to be a serine protease. Theimplications for these findings are discussed. Methods Cell culture RPMI 8226 MM, CESS Epstein-Barr virus (EBV)-trans-formed normal B cells, K562 chronic myeloid leukemia(CML), and HL-60 APL human cell lines were all pur-chased from the American Type Culture Collection(ATCC, Rockville, MD). The EBV-negative SGH-MM5human MM cell line (CD10+ CD19- CD20- CD38+CD40+ CD45+ CD56+ CD138+) was developed in our laboratory under the Singapore General Hospital (SGH)Institutional Review Board (IRB) good research practiceguidelines, from a patient with MM using a modified Dex-ter-type long-term tissue culture system, which was previ-ously described [23]. All cell lines were cultured in RPMI1640 medium (Invitrogen, Gibco, Grand Island, NY) sup-plemented with 10% fetal calf serum (FCS) at 37°C and5% CO 2 . Normal PB human T cells were isolated frombuffy coat preparations from healthy donors (after informed consents were obtained) using Ficoll Hypaquedensity gradient centrifugation and CD3 positive mag-netic bead immunoseparation (MACS columns, MiltenyiBiotec, GmbH, Gladbach, Germany). For CD40 stimula-tion conditions, MM cells were optimally stimulated withsoluble CD40 ligand (sCD40L) (Peprotech Inc., Rocky Hill, NJ) for 4 hrs at 5.0 ng/mL [23]. Cell extract preparation Fresh whole cell extracts Cells were washed in phosphate buffered saline (PBS),pelleted, resuspended in 2× sodium dodecyl-sulfate (SDS)loading buffer (120 mM Tris HCl pH 7.0, 4% SDS, 720mM 2-mercaptoethanol (2-ME), 0.01% bromophenolblue and 20% glycerol), and directly boiled for 10 mins toinactivate proteases [22] as previously described. Wholecell extracts were then recovered by centrifugation at 12,000  g for 10 mins and loaded equally and immediately onto SDS polyacrylamide gel electrophoresis (PAGE) gels. Conventional whole cell extracts Cells were lysed in EBC1 lysis buffer (50 mM Tris HCl, pH8.0, 150 mM NaCl, 0.1% NP-40, 50 mM NaF, 1 mMNa 3  VO 4 , 0.5 µ g/ml phenylmethylsulphonylfluoride(PMSF), and 1 freshly added tablet of protease inhibitor   Cancer Cell International   2008, 8 :4http://www.cancerci.com/content/8/1/4Page 3 of 13 (page number not for citation purposes) mixture per 50 ml of buffer (Complete™ protease inhibi-tor tablets; Boehringer Mannheim, Roche DiagnosticsGmbH, Mannheim, Germany). The mixture was thenboiled in SDS sample buffer for 3 to 5 mins before loading onto SDS-PAGE gels. Conventional cytosolic protein extracts Cells were first washed in PBS and lysed in 10 volumes of the lysis buffer (10 mM Tris HCl pH 7.6, 1.5 mM MgCl 2 ,10 mM KCl, 0.5% NP-40, 1 mM dithiotretinol (DTT), and1 freshly added Complete™ protease inhibitor tablet).Cytosolic protein extracts were recovered by centrifuga-tion at 1,000  g for 15 mins [20]. Conventional nuclear protein extracts From the above pellet, cell nuclei were next lysed in 5 vol-umes of a low-salt buffer (20 mM HEPES pH 7.9, 25%glycerol, 1.5 mM MgCl 2 , 10 mM KCl, 0.5 mM ethylenedi-aminetetraacetic acid (EDTA), and 1 freshly added Com-plete™ protease inhibitor tablet). Next, an equal volumeof a high-salt buffer (i.e. low-salt buffer plus 0.8 M NaCl) was added, and the mixture left to stand on ice for 15mins. [20]. Nuclear protein extracts were recovered by centrifugation at 16,000  g for 15 mins.  Membrane protein extracts Cells were washed three times with ice-cold PBS, centri-fuged at 3,000  g for 5 mins, and the pellet resuspended in0.5 ml of TEM A lysis buffer (20 mM Tris HCl pH 8.0, 0.5mM EDTA, 0.5 mM EGTA, 10 mM 2-ME, and 1 freshly added Complete™ protease inhibitor tablet), incubatedon ice for 5 mins, and then sonicated. Membrane proteinextracts were obtained by double sequential centrifuga-tion of the lysis mixture, first at 1,000  g for 5 mins, then at 100,000  g for 30 mins for 250 µ L of the supernatant. For all the assays above, Bradford's assay (Bio-Rad, Hercules,CA) was used to quantify protein concentrations in allsamples. Western immunoblotting  Cell lysates (20.0 µ g of protein/sample) were first resolvedon a 12.5% SDS-PAGE gel, transferred onto polyvinyli-dene difluoride (PVDF) membranes (Millipore Corpora-tion, Billerica, MA) and then blocked using Tris bufferedsaline Tween-20 (TBST) buffer containing 5% non-fat milk. Membranes were next hybridized overnight in thecold room using various murine monoclonal antibodies(mAb) – i.e. S10B1 anti-Ku86 N-terminus (amino acid(aa) residues 8–221; NeoMarkers, Fremont, CA); anti-heavy chain of the human major histocompatibility com-plex (MHC) mAb (clone 22.63.4, Accurate Chemical andScientific Co., Westbuty, NY; a kind gift from P. Macary,from the National University of Singapore); and anti-actin(Santa Cruz Biotechnology, Santa Cruz, CA) mAbs; washed three times in ice cold TBS-T; and then incubated with horseradish peroxidase (hrp) conjugated anti-mouseIgG mAb (1:2,000; Santa Cruz) for 1 hr. The reaction wasdetected using the ChemiGlow chemiluminescence rea-gents (Alpha Innotech, San Leandra, CA). Image spot den-sitometry was performed on the Alpha Imager (AlphaInnotech). Electrophoretic mobility shift assay (EMSA)  Two 25-mer oligonucleotides; 5'-ACTTGATTAGTTACG- TAACGTTATG-3' and 5'-CATAACGTTACGTAACTAAT-CAAGT-3', with or without biotin labels at the 5' ends (1 st  Base Pte Ltd., Singapore), were first annealed together (seePierce Technical Resource, TR0045.0, Pierce, Rockford,IL). Standard EMSA reactions (Lightshift Chemilumines-cent EMSA kit, Pierce) incorporated 4.0 µ g of cell extract and 20.0 fmol of biotin end-labeled DNA in a 20.0 µ L vol-ume binding reaction in the presence of 2.5% glycerol, 5mM MgCl 2 , 50 ng/ µ L of poly(dI·dC), and 0.05% NP-40.Unlabeled target DNA (4.0 pmol) was added per 20.0 µ L of binding reaction where indicated. Reactions were incu-bated at room temperature for 30 mins and terminated by adding 2.0 µ L of 10× loading buffer (0.2% (w/v)bromophenol blue and 0.2% xylene cyanol containing 10% (v/v) glycerol). Assays were loaded onto native 5%polyacrylamide gels that were pre-electrophoresed for 60mins in 0.5× Tris borate/EDTA buffer, resolved at 100 V,and transferred onto nylon membranes (Hybond™-N + , Amersham) in 0.5× Tris borate/EDTA buffer at 100 V for 30 mins. DNA was cross-linked (120 mJ/cm 2 ) anddetected using hrp-conjugated streptavidin chemilumi-nescence. Image spot densitometry was performed on the Alpha Imager (Alpha Innotech). Endoglycosidase H (EndoH) digestion Endoglycosidase H resistance was assayed using theEndoH digestion system (New England Biolabs, Ipswich,MA) and performed according to the manufacturer's rec-ommendations. Briefly, 30.0 µ g of whole cell extracts weredenatured at 100°C for 10 mins using 1× glycoproteindenaturing buffer, followed by addition of 1× G5 buffer and 1.0 µ L (500 units) of EndoH. The reaction mix wasincubated at 37°C; and at various time points, aliquots were removed and resolved in a 12.5% SDS-PAGE gel for carbohydrate (CHO) release. Intracellular inhibition of protease digestion In order to inhibit intracellular protease activity, 5 × 10 6 cells/sample were treated with: Complete™ proteaseinhibitor tablets; either 1× (1 tablet for every 50 mL of media) or 2× (2 tablets for every 50 mL of media); or treated with antipain (2.0 µ g/mL) plus leupeptin (2.0 µ g/mL) (both from Sigma-Aldrich, St Louis, MO, USA) for cysteine protease inhibition; or aprotinin (2.0 µ g/mL)plus PMSF (100 µ g/mL) (both from Sigma-Aldrich) for serine protease inhibition; for to 24 hrs. Cell viability was  Cancer Cell International   2008, 8 :4http://www.cancerci.com/content/8/1/4Page 4 of 13 (page number not for citation purposes) assessed by standard trypan-blue exclusion assays. Imagespot densitometry was performed on the Alpha Imager (Alpha Innotech). Cloning of Human Ku86 from RPMI cells Full-length 2.4 kb Ku86 cDNA was obtained from totalRNA of RPMI 8226 MM cell lines by RT-PCR (Qiagen Inc., Valencia CA, USA). The primers used to amplify the Ku86message were forward primer: 5' -TGTATGGACGT-GGGCTTTACCAT-3' and reverse primer: 5' -TCCACAGA-GAATTAGATGATCCGCC-3'. Purified Ku86 cDNA (2.4kb) was then cloned into Topo-vector (Invitrogen) andtransformed into E. coli . The cloned Ku86 gene was fully sequenced to confirm the insertion of full length 2.4 kbKu86 into the clone without any detected mutations(BigDye™ Cycle Sequencing Kit, Applied Biosystems, Fos-ter City, CA USA). In order to subclone the construct intoan mammalian expression system, two restriction enzymesites were engineered to the ends of cloned Ku86 gene( Hin dIII at 5' end and  Xba I at 3' end) by PCR of the cloneusing high fidelity PWO SuperYield™ DNA polymerase(Roche Diagnostics) and the following oligo's: Forwardoligo: 5'- ATTAAAGCTTCCGGCAACATGGTGCGGTCGGGGAATA  AGGCAGCTGTTGTGCTGTGTATGGACGTGGGC-3' andReverse oligo: 5'ATTATCTAGACTTATCATGTCCAATA  AATC-3'. The engineered Ku86 was then subcloned intothe transient mammalian expression vector, pcDNA3.1/myc-His B (Invitrogen). The purified plasmid (Ku86+pcDNA3.1/myc-His B) was then transfected into mamma-lian cell line (COS-7) for transient expression of Ku86recombinant protein, using the Lipofectamine 2000™ rea-gent (Invitrogen). Finally, the Ku86 recombinant proteins were purified using ProBond™ Nickel-Chelating Resin col-umn (Invitrogen) and detected using westernImmunblotting with anti-myc-HRP (Invitrogen) and/or anti-Ku86 antibody (Neomarker). Trypsin digestion of recombinant human Ku86 (rhKu86)  protein Full-length rhKu86 was first expressed and purified fromCOS cells and digested (6.5 µ g/sample or 13.0 µ g/sample)using trypsin (0.065 µ g of Trypsin Gold/reaction,Promega Corp. Madison, WI); at 100:1 protease:proteinratio, in 50 nM acetic acid, pH 8.0, and 37°C, as recom-mended at by the manufacturer (Promega Technical Bul-letin, 309). The reaction was stopped by rapid freezing onice, and analyzed using SDS-PAGE and western immuno-blotting. Results and Discussion Ku86 truncation is not the result of in vitro generated  proteolysis in MM cell lines  Although a number of studies have characterized a 69-kDa to 70-kDa truncated variant of Ku86 in vitro , a few recent studies have suggested that this variant may be theresult of in vitro induced proteolysis during storage, han-dling and lysis of B or T lymphocytes [21,22]. In this present study, an SDS-PAGE whole cell lysis procedure, in which all proteolytic activity is inhibited during isolation, was used to demonstrate that RPMI 8226 and SGH-MM5MM cells (Fig. 1 A, lanes 5 and 6) contain a 69-kDa N-ter-minus Ku86v despite the omission of the protein extrac-tion steps and minimization of protease action. Incontrast, and in agreement with prior findings, human T cells (samples from patient 1; Fig. 1 A, lane 1) freshly iso-lated from the PB did not display altered forms of Ku86.Furthermore, CESS EBV-transformed B cell and K562CML cell lines (Fig. 1 A, lanes 2 and 3), which are knownto lack the expression of the 69-kDa variant of Ku86,served as negative controls; and the HL-60 APL cell line(Fig. 1 A, lane 4), which is known to contain the 69-kDaform of Ku86v, was used as a positive control for thisassay. These data suggest that the 69-kDa form of Ku86v is generated in vivo , and is not likely to be an in vitro arti-fact, in human MM cell lines.In order to demonstrate in vitro proteolysis of Ku86, wenext analyzed protein extracts prepared using conven-tional methods from previously frozen and stored cells(Fig. 1B). Specifically, human T cells (samples frompatients 2 and 3), CESS and the K562 cell lines, that lack 69-kDa Ku86v expression (Fig. 1B, lanes 1 to 4); werecompared with the HL-60 cell line, which is known toexpress 69-kDa Ku86v, RPMI 8226, and SGH-MM5 MMcell lines (Fig. 1B, lanes 5 to 7). In this experiment, bothhuman T cells, as well as the CESS and K562 cell lines not only contained 69-kDa Ku86v, but also various other frag-ments of Ku86. Moreover, even HL-60, RPMI 8226 andSGH-MM5 cell lines, that constitutively express 69-kDaKu86v, also contained numerous Ku86 fragments. Thesedata suggest that freezing and storage of cells leads toextensive in vitro proteolysis of cellular proteins. Further-more, whole cell extracts from the RPMI 8226 cell line, which were made in a protease-free extraction buffer, i.e.either extraction buffer plus 1× Complete™ tablet (RocheDiagnostics) and 1× PMSF, or extraction buffer plus 2×Complete™ tablets and 2× PMSF, demonstrated no changein the expression of the Ku86 variant or its full-lengthform (data not shown). Collectively, these data confirmthat although proteases released during isolation proce-dures can lead to extensive Ku86 degradation in vitro ,truncated forms of Ku86 in RPMI 8226 and SGH-MM5MM cell lines are more likely to have been generated invivo and constitutively. The 69-kDa Ku86v in MM cell lines are present in the cytosolic, nuclear and membrane fractions and binds DNA Since CD40 activation of MM cell lines results in themembrane expression of Ku86 in MM cells [6,12,12], we  Cancer Cell International   2008, 8 :4http://www.cancerci.com/content/8/1/4Page 5 of 13 (page number not for citation purposes) also investigated the distribution of 69-kDa Ku86v in var-ious subcellular locations, i.e. cytosol, nucleus and cellmembrane, relative to CD40 triggering. As can be seen inFig. 2 A, 69-kDa Ku86v is present in all subfractions but isat higher (2.5-fold) levels in the cytosol after CD40 trig-gering of the RPMI 8226 MM cell line. In order to definea functional role for this observation, we analyzed theDNA-binding characteristics of Ku86 and Ku86v to aknown 25-bp Ku86 binding DNA oligonucleotide using EMSAs (Figs. 2B and 2C) [16,22], in CD40-triggered RPMI 8226 MM cells in various subcellular fractions. We dem-onstrate binding of DNA to both 86-kDa Ku86 (bandposition I) as well as 69-kDa Ku86v (band position II);confirming the presence of these proteins in the RPMI8226 MM cell line. In contrast, only full-length Ku86 wasfound in the negative control CESS cells. Similar results were obtained for the SGH-MM5 MM cell line (data not shown). Interestingly, no other bands are detected sug-gesting that if other forms of Ku86 exist they do not bindDNA. Moreover, cold competitor DNA was used to con-firm specificity of the 25-bp oligonucleotide for Ku86binding (Fig. 2C). Since the DNA binding domain of Ku86 is located in the N-terminus and is preserved in bothfull-length Ku86 as well as the 69-kDa Ku86v, our datanot only confirms the presence of truncated Ku86v, but also suggests a functional role for Ku86v.Surprisingly, triggering of MM cells via CD40 had noeffect on the amount of 86-kDa Ku86 protein bound toDNA in all cellular subfractions (Fig. 2B, band position I)isolated from RPMI 8226 cells and well as SGH-MM5 MMcell line (data not shown). By contrast, binding of 69-kDa Ku86 truncation is not the result of in vitro generated proteolysis in human MM cell lines Figure 1Ku86 truncation is not the result of in vitro generated proteolysis in human MM cell lines . Immediate whole cell lysis (5.0 × 10 6 cells/sample) was performed on freshly-obtained human PB T cells (sample from patient 1), CESS, K562, HL60, and RPMI 8226 and SGH-MM5 MM cell lines using a denaturing and reducing gel-loading buffer (95°C for 10 mins) (A). Cell extracts were also prepared using conventional methods from previously frozen and stored human PB T cells (samples from patients 2 and 3), K562 CML, and HL60, and RPMI 8226 and SGH-MM5 MM cell lines (B). Cell lysates (20.0 µ g/sample) were resolved on a 12.5% SDS-PAGE gel, transferred onto PVDF membranes, and probed with S10B1 anti-Ku86 mAb, which recog-nizes the N-terminus of Ku86. Membranes were stripped and re-probed using anti-actin mAb (control) to confirm equal pro-tein loading. Experiments were performed in triplicate.
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks