Essays

Loss of photoreceptor potential from retinal progenitor cell cultures, despite improvements in survival

Description
Retinal degeneration (RD) results from photoreceptor apoptosis. Cell transplantation, one potential therapeutic approach, requires expandable stem cells that can form mature photoreceptors when differentiated. Freshly dissociated primary retinal
Categories
Published
of 13
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Loss of photoreceptor potential from retinal progenitor cell cultures,despite improvements in survival Fiona C. Mansergh a , * , Reaz Vawda a , b , Sophia Millington-Ward a , Paul F. Kenna a , Jochen Haas c ,Clair Gallagher d , John H. Wilson e , Peter Humphries a , Marius Ader a , c , G. Jane Farrar a a Ocular Genetics Unit, Smur    t Institute of Genetics, Trinity College Dublin, Lincoln Place Gate, Dublin 2, Ireland b Fighting Blindness Vision Research Institute, 1 Christchurch Hall, Dublin 2, Ireland c DFG-Center for Regenerative Therapies Dresden, Cluster of Excellence/TU Dresden, c/o MTZ, Fiedlerstr. 42, 01307 Dresden, Germany d National Institute of Cellular Biotechnology (NICB), Dublin City University, Glasnevin, Dublin 9, Ireland e Department of Biochemistry and Molecular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA a r t i c l e i n f o  Article history: Received 6 May 2010Accepted in revised form 7 July 2010Available online 15 July 2010 Keywords: retinal progenitor cellscell cultureFACSrhodopsinphotoreceptorretina a b s t r a c t Retinal degeneration (RD) results from photoreceptor apoptosis. Cell transplantation, one potentialtherapeutic approach, requires expandable stem cells that can form mature photoreceptors whendifferentiated. Freshly dissociated primary retinal cells from postnatal day 2 e 6 (PN2 e 6) mouse retinacan give rise, post-transplantation, to photoreceptors in adult recipients. Unfortunately, incorporationrates are low; moreover, photoreceptor potential is lost if the same PN2 e 6 cells are cultured prior totransplantation. We investigated the identity of the cells forming photoreceptors post-transplantation,using FACS sorted primary postnatal day (PN) 3 e 5 Rho-eGFP retinal cells. Higher integration rates wereachieved for cells that were expressing Rho-eGFP at PN3 e 5, indicating that post-mitotic photoreceptorprecursors already expressing rhodopsin form the majority of integrating rods. We then investigatedimprovement of cell culture protocols for retinal progenitor cells (RPCs) derived from PN3 e 5 retinal cellsin vitro. We succeeded in improving RPC survival and growth rates 25-fold, by modifying retinaldissociation, replacing N2 supplement with B27 supplement minus retinoic acid (B27  RA) and coating  asks with   bronectin. However, levels of rhodopsin and similar photoreceptor-speci  c markers stilldiminished rapidly during growth in vitro, and did not re-appear after in vitro differentiation. Similarly,transplanted RPCs, whether proliferating or differentiated, did not form photoreceptors in vivo. CulturedRPCs upregulate genes such as Sox2 and nestin, markers of more primitive neural stem cells. Use of thesecells for RD treatment will require identi  cation of triggers that favour terminal photoreceptor differ-entiation and survival in vitro prior to transplantation.   2010 Elsevier Ltd. All rights reserved. 1. Introduction Retinal degeneration (RD) involves the gradual loss of photo-receptors by apoptosis, causing visual impairment and eventualblindness. Inherited RD is genetically heterogeneous. To date, over190 loci have been identi  ed (RetNet; http://www.sph.uth.tmc. edu/Retnet/). The disability associated with various forms of RDcarries a great social and economic cost. Retinitis pigmentosa (RP)affects 1 in 3000 people, while age related macular degeneration(AMD) affects as many as 1 in 10 over-65s. Gene therapy-basedapproaches have shown therapeutic promise in clinical trials(Maguire et al., 2008,2009; Bainbridge et al., 2008; Cideciyan et al.,2008), but require some surviving cells in order to work. Celltherapy for advanced disease may provide a complimentaryapproach.A variety of stem cell sources have been identi  ed, includingciliary epithelial cells (CE), retinal progenitor cells (RPCs, derivedfrom embryonic or early postnatal neural retinas), embryonic stem(ES)cells,andinducedpluripotentstem(iPS)cells.Ciliaryepithelialcells (CE) are derived from the ciliary margin and can generatespheres in culture which upregulate neuro-retinal genes (Tropepeet al., 2000; Coles et al., 2004; Das et al., 2005), However, recentreports note that these cells fail to form  bona   de  retinal neuronsand glia (Cicero et al., 2009; Gualdoni et al., 2010); this source of stem cells has therefore not been investigated further here. *  Corresponding author. Tel.:  þ 353 1 8962484; fax:  þ 353 1 8963848. E-mail addresses:  mansergf@tcd.ie (F.C. Mansergh), reaz.vawda@  ghtingblindness.ie (R. Vawda), sophia@maths.tcd.ie (S. Millington-Ward), pfkenna@tcd.ie (P.F. Kenna),  jochen.haas@crt-dresden.de (J. Haas), clair.gallagher@dcu.ie (J.H. Gallagher), jwilson@ bcm.tmc.edu (J.H. Wilson), pete.humphries@tcd.ie (P. Humphries), marius.ader@crt- dresden.de (M. Ader), gjfarrar@tcd.ie (G.J. Farrar). Contents lists available at ScienceDirect Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer 0014-4835/$  e  see front matter    2010 Elsevier Ltd. All rights reserved.doi:10.1016/j.exer.2010.07.003 Experimental Eye Research 91 (2010) 500 e 512  Transplantation studies have shown that a sub-fraction of freshlydissociatedcellsfromPN2 e 6mouseretinascanintegrateintoadulthost retina, show morphology characteristic of photoreceptors andcan ameliorate symptoms of RD (MacLaren et al., 2006; Bartschet al., 2008; West et al., 2008, 2009). Similar transplants usingcultured cells derived from embryonic to postnatal day 6 retinas(RPCs) (or, indeed, freshly dissociated primary retinal cells fromembryonic retinasor retinasolderthanthe  rstpostnatalweek)donot result in photoreceptor morphology. Optimal integrationcoincides with the birth of rod photoreceptors. Integrated cells arethought to be post-mitotic (MacLaren et al., 2006; West et al.,2009). Moreover the frequency of integration is low even at PN4(0.6%), and transplantation is less successful in diseased retinas,perhaps because of the gliosis that accompanies RD (West et al.,2009). Disruption of the outer limiting membrane (OLM; a barrierbetween the subretinal space and the outer nuclear layer) canincrease the proportion of integrating cells; however, percentagesare still small (West et al., 2008, 2009).Primary retinal cells dissociated from late embryonic (E14.5 andsubsequent) and early postnatal mouse retinas can be expanded intissue culture. Adherent cultures are established within a few days,can be passaged after 1 month, and can be grown inde  nitely(Klassen et al., 2004; Qiu et al., 2004; Angénieuxet al., 2006; Merhi-Soussi et al., 2006). These cells are described here as retinalprogenitor cells (RPCs). RPCs are typically expanded in serum-freemediaoptimizedforneuralcultureswithN2supplement(orsimilar),epidermalgrowthfactor(EGF)and  broblastgrowthfactor2(FGF2),which have both been shown to have a proliferative effect on thesecells (Kelley et al., 1995; Chacko et al., 2000; Das et al., 2005).Moreover, there are indications that EGF, which biases towards glialcell fate in neural stem cell cultures, can act as a potent neuralizingfactor in retinal cells (Angénieux et al., 2006). Plating on laminin,sometimeswithpoly-L-ornithine,andsequentialwithdrawalofEGF,then FGF2   ve days later, is used to differentiate RPCs in vitro, fol-lowed by addition of B27 supplement. Adherent RPCs, classi  edvariously as retinal stem cells, retinal progenitor cells, retinalprecursor cells, radial glial cells and/or proliferating Mueller glia,show a capacity to generate retinal neurons, including thoseexpressingphotoreceptormarkers(Klassenetal.,2004;Merhi-Soussiet al., 2006; Canola et al., 2007). Cultured RPCs transplanted eithersubretinally or intravitreally can integrate into the retina and havebeen shown to generate some level of therapeutic effect (Klassenet al., 2004). However, reports of photoreceptor morphology arisingfromtransplantationofpostnatalrodentRPCculturesarediscordant(Klassen et al., 2004; Reh, 2006; Canola et al., 2007; Lamba et al.,2008; West et al., 2009), with the majority now suggesting thatsuch events are rare or non-existent (West et al., 2009).Retinal differentiation protocols have been developed for RPCs,embryonic neural stem cells, ES and iPS cells (Zhao et al., 2002;Merhi-Soussi et al., 2006; Aoki et al., 2008; Meyer et al., 2006,2009; Lamba et al., 2006, 2010; Ikeda et al., 2005; Osakada et al.,2008; Jagatha et al., 2009; Hirami et al., 2009). ES or iPS-derivedcells also give relatively low integration rates of 0.1 e 0.5% of cellsinitially transplanted, although some photoreceptor morphology isachieved(Osakadaetal.,2008;Lambaetal.,2009,2010).Theabilitytogeneratepureexpandableculturesfromwhichlargernumbersof photoreceptors can be obtained is a pre-requisite for RD cellulartherapies.Firstly, we have investigated the identity of the primary retinalcells that can integrate and give rise to photoreceptors. We havefoundthatPN3 e 5Rho-eGFPprimaryretinalcellsalreadyexpressingrhodopsin at PN3 e 5 are more likely to integrate into the outernuclear layer (ONL) and form morphologically mature photorecep-tors after transplantation than those Rho-eGFP cells not expressingrhodopsinatthepointoftransplantation.CellsexpressingrhodopsinatPN3 e 5arealmostcertainlypost-mitotic,asrhodopsinisaproductof terminal rod differentiation. Rhodopsin expression is thereforea good marker for photoreceptor potential post-transplantation;however,thisisrapidlylostfromRPCcultures.Wehypothesizedthatsub-optimal initial culture conditions may result in poor survival of photoreceptor precursors. However, we have achieved a 25-foldimprovement in growth rate via extensive protocol changes, but noincreases were observed in rhodopsin expression levels or integra-tion rates post-transplantation, regardless of whether proliferatingor differentiated RPCs were analysed. Expression patterns of markergenes in proliferating RPCs show that they are undifferentiated;hence, we are losing cells that have already chosen a photoreceptorcellfate. Rapid lossof rhodopsinexpression after introduction of thecellstotissuecultureindicates thatthemajorityofpost-mitoticcellsare dying within 3 days. Identifying cues by which retinal progeni-tors are speci  ed in vivo, and culture conditions that promotesurvival in vitro after speci  cation, but prior to injection, will benecessary for therapeutic use of these cells in RD. However, theimprovements in isolation and growth rates described here will beuseful to anyone who might wish to investigate the therapeuticpotential of these cells for disorders such as glaucoma, Leber ’ shereditary optic neuropathy, or retinoschisis, where the defect doesnot lie within the photoreceptor layer. 2. Materials and methods  2.1. Retinal dissociation and FACS analysis ForFACSexperiments,weusedpostnatalPN3 e 5rhodopsin-eGFP(Rho-eGFP; Chan et al., 2004) heterozygote mice as donors for FACSand subsequent transplantation. These mice express a human Rho-eGFP fusion protein that is visible in rod outer segments followingtransplantation. Heterozygotes were used in our experiments ashomozygotes show symptoms of retinal degeneration (Chan et al.,2004). Retinas were dissected and placed in 1ml HBSS (Lonza). Theciliary margin was removed from all retinas prior to dissociation.Retinal cells were analysed by FACS as previously described (Pal  et al., 2006). Following FACS analysis, cells were spun at 2000rpmfor5minandresuspendedsuch thatthe approximateconcentrationof cells was 200,000 per 3 m l (cell count obtained from FACS).Followingsubretinalinjection(seebelow),residualcellsampleswerecounted using a haemocytometer in order to assess the actualnumber and viability of cells injected (given the time elapsed, thiscouldvarysubstantiallyfromFACS  gures).Foreachtimepoint,FACSsortingwascarriedout3timesandforeachrepetition,atleast3eyeswere injected with positive and 3 eyes with negative cells. Unsortedcells were also transplanted as a control. Animals were sacri  ced 3months post-transplantation, eyes were sectioned as describedbelow. Given the fact that eGFP, in Rho-eGFP cells, is expressed asa rhodopsin-eGFP fusion protein, positive cells were identi  ed viaeGFP positive, morphologically correct outer segments adjacent tothe RPE.  2.2. Animals, transplantation, cryosectioning, eGFP transplantation cell counts For transplantation studies involving cultured RPCs, cells wereisolated at PN3 e 5 from transgenic mice ubiquitously expressingeGFP (Okabe et al., 1997). Recipients for all transplantations wereC57Bl6/J mice between 2 and 6 months of age. For tissue culturestudies, PN3 e 5 Rho-eGFP, eGFP, C57Bl6/J and Rho  /   donor mice(Humphries et al., 1997) were used. Subretinal injections werecarried out in strict compliance with EU and Irish law (Cruelty toAnimals Act 2002) and with the ARVO statement for animal use inophthalmic research. Anaesthesia and subretinal injections were F.C. Mansergh et al. / Experimental Eye Research 91 (2010) 500 e 512  501  carried out as previously described (Chadderton et al., 2009). Fixa-tion, cryosectioning and staining were carried out as previouslydescribed (Kiang et al., 2005). All sections were cut at 12.5  m mthickness and were DAPI stained. Cells were counted on a   uores-cent microscope (Zeiss, Axioplan 2); channels speci  c for RFP werechecked for each positive cell to ensure omission of false positivesdue to auto  uorescence. eGFP-positive cells were counted indifferentcategories,dependingonretinallocationandmorphology.Cells were counted as either unincorporated (balls of unintegratedcells adjacent to the injection site, for example), retinal (havingmigrated into the retina but with no evidence of integration),integrated (visible evidence of axons, dendrites etc), or possessingphotoreceptormorphology(seeabove).Photoreceptormorphologywas not seen following transplantation of cultured RPCs, only aftertransplantationoffreshretinalcells.Ineveryinstance,theentireeyewas sectioned and all 12.5  m m sections obtained were mounted,DAPI stained and counted. Following sectioning and counting,numbers of correctly integrated cells were divided by the srcinalnumber injected (haemocytometer   gures used for FACS cells) andmultiplied by 100 to give the percentage of integrated cells,photoreceptorsetc.ResultsweregraphedusingGraphPadPrism3.0.  2.3. Retinal dissociation for subsequent tissue culture Retinaswereplacedin1mlPBSorHBSSfollowingdissection.Theciliary margin was removed from all retinas prior to dissociation, inorder to avoid contamination by CEcells insubsequent cultures.  Olddissociationmethod :Retinaswereplacedin1mlHBSS(Lonza)and100 m l 10mg/ml trypsin (Sigma) was added. Retinas were incubatedfor 10min at 37   C, after 5 min, 10  m l 10 m g/ml DNase1 þ 100 m l20mg/ml trypsin inhibitor were added and samples were trituratedwithaP1000pipette(Gilson).Cellswerespunfor5 minat2000rpm(Thermo Microlite microcentrifuge) and cells were resuspended in1ml growth medium.  New methods:  100 m l 0.25% trypsin/EDTA(Lonza/Biowhittaker)or100  m lAccutase(Sigma)wereadded,retinaswere incubated for 5min at 37  C, allowed to settle to the bottom of the tube and most of the supernatant was aspirated away. 1mlgrowth medium was then added and retinas were dissociated bytrituration with a   re polished Pasteur pipette. Retinas prepared viamechanical dissociation followed the same procedure, but omittingenzymatic digestion. Following dissociation, cells were counted fourtimes using a haemocytometer.  2.4. Tissue culture 2.4.1. Media, supplements, growth factors Neurobasalmedium,B27andB27withoutVitaminA(B27  RA)were obtained from Invitrogen; DMEM/F12, embryonic and post-natal stem cell media were from Sigma. Growth medium for RPCswas composed of DMEM/F12 supplemented with 1   N2, 1   B27,1  B27  RA or a combination thereof.1  L-glutamine (Lonza),1  penicillin/streptomycin (Lonza), 5  m g/ml heparin (Sigma), 20 ng/ml  broblast growth factor 2 (FGF2) and 20 ng/ml epidermal growthfactor (EGF) were also added. RPCs were grown in Sarstedt T25  asks; other plastics were less conducive to growth. Neurobasaland other media were supplemented as for DMEM/F12.  2.4.2. Differentiation Cells were differentiated in vitro by plating cells on laminincoated T25s or poly-L-lysine and laminin coated glass cover slips.After 2 e 4 days, EGF was withdrawn from the medium for 5 days,followed by use of    nal growth medium supplemented withB27 þ RA and no growth factors for 5 e 7 days. Glial differentiationcan be enhanced by adding 1% fetal calf serum (FCS) to the   nalgrowth medium.  2.4.3. Substrates Collagen,   bronectin, laminin, poly-L-ornithine, poly-L-lysine,poly-D-lysine and vitronectin were obtained from Sigma, whilegelatinwasobtainedfromMillipore.Allwereappliedat0.1%for2 hat room temperature or overnight at 4   C. Flasks were rinsed in 1  PBS (Lonza) twice before addition of media and cells.  2.4.4. Dissociation Cells were placed in T25   asks at a noted cell density in 5 mlgrowth medium and incubated at 37   C and 5% CO 2 . After initialplating, the medium was replaced completely after 5 e 7 daysinitially, then every 2 e 7 days depending on density.  2.4.5. Passaging  Cells were passaged when 80 e 90% con  uent. 0.5 ml 0.25%trypsin/EDTA (Lonza) or Accutase (Sigma) were added to each T25  ask,following removalofmediumand rinsingwith1  PBS.Flaskswere incubated for 5 e 10 min until cell monolayers lifted off. Cellswereresuspendedin3 mlDMEM/F12,countedfourtimesandspunat 1000 rpm. The supernatant was removed, pellets were resus-pendedingrowthmediumandreplated,frozen,ortreatedwithTRIreagent (Sigma).  2.4.6. Calculations Initial cell density and date of plating were noted for each   ask.The number of days to reach 80 e 90% con  uence was also noted.Cells were counted at each passage (p) and the rate of cell growthwas calculated as follows: Increase in cell no :  per day ¼ ðð Cell no :  at pN þ 1 Þð Cell no :  at pN ÞÞ No :  of days between pN þ 1 and pN  2.4.7. Freezing  Cells were resuspended in 1 ml freeze medium (7.5% glucose,10%BSAor1%B27  RA,10%DMSO,madeupinDMEM/F12medium(Sigma)), placed in a Mr Frosty and frozen at  70  C. Thawed cellswere placed in 5 ml DMEM/F12 and spun before replating.  2.5. RNA extraction Cell pellets were resuspended in 1 ml TRI reagent (Sigma) andtriturated using a P1000, while retinas were homogenized in 1 mlTRI reagent using a Dounce homogenizer (Fisher). RNA wasprepared according to the manufacturer ’ s protocol. RNA sampleswere assayed for concentration and quality using a NanodropND1000 (NanoDrop Technologies) spectrophotometer.  2.6. RT-PCR Reverse transcription was carried out as previously described(Manserghet al.,2009). PrimerswereobtainedfromSigma-Genosys(see Table 1). PCRs were carried out using Crimson Taq and buffer(NEB)accordingtothemanufacturer ’ sinstructions.A “ noRT ” controlcorresponding to each sample was included. Housekeeping genes(beta-actin, Gapdh,18S rRNA) were also tested by DNA based Q-PCR to ensure that CT values for each gene were within a similar range( < 1.5CT difference from an average obtained for all samples).  2.7. Q-PCR HPLC puri  ed primers were obtained for one step real-timeQ-PCR (Sigma-Genosys). 5 m l of each RNA sample was treated withDNAfree (Ambion) in a total volume of 30 m l according to the F.C. Mansergh et al. / Experimental Eye Research 91 (2010) 500 e 512 502  manufacturer ’ s protocol. Q-PCRs were carried out using either RNAor DNA with the appropriate one step or two step QuantiTect kits(Qiagen) as described previously (O ’ Reilly et al., 2007). Slopes wereobtained for all Q-PCR primers used with respect to beta-actin. Allwere  < 0.1; allowing use of the  DD Ct method to calculate foldchanges.  2.8. Immunocytochemistry Cellswereallowedtoattachtopoly-L-lysineand laminincoated10 e 13 mm diameter cover slips placed in 12 or 24 well tissueculture plates, in growth medium. For differentiated cells, differ-entiation medium was applied after 24 h, followed after 5 days by  naldifferentiationmedium,forafurther5days.Cellsweretreatedwith 4% PFA for 10 min, rinsed with 1   PBS 4 times, then treatedwith blocking solution (0.1% Triton,10% donkey serum,1% BSA) for15 min. Primary antibodies GFAP (1/1000 dilution, Sigma), nestin,(1/100 dilution, DSHB),  b -III-tubulin (1/4000 dilution, Covance),Pax6 (1/500 dilution, Covance), glutamine synthetase (1/250, BDBiosciences), rhodopsin (1/100, Chemicon) and synaptophysin(1/300, Sigma) wereadded at the stated dilutions for 30 e 60 min atroom temperature. 3 washes of 1  PBS were carried out, followedby one of 3% BSA. Secondary antibody (1/100 e 1/1000 Cy3 anti-mouse, Cy3 anti-rabbit, Cy2 anti-mouse as appropriate, JacksonImmuno-Research) was then applied for 1 h. 2  washes of 1  PBS,1washof1  PBS þ DAPIanda  nal1  PBSwashwerethencarriedout. Slides were inverted on poly-L-lysine coated slides usingAquaPolyMount (PolySciences), dried at 4   C overnight and pho-tographed on a   uorescent microscope (Zeiss, Axioplan 2). 3. Results  3.1. FACS analysis and transplantation Inordertoinvestigatetheidentityofcellsthatcanintegrateandgive rise to photoreceptors, we used FACS sorting with primaryretinal cells from Rho-eGFP mice. Rhodopsin expressing, eGFP-positive cells from PN3 e 5 Rho-eGFP donor mice were separatedfrom non-rhodopsin expressing, eGFP-negative PN3 e 5 Rho-eGFPcells from the same retinas, using FACS. PN3 e 5 cells expressingrhodopsin were then transplanted into 2 e 6 month old C57Bl/6Jrecipients separately from FACS sorted Rho-eGFP cells notexpressing rhodopsin. Animals were sacri  ced after 3 months,longer than the 2 e 4 week intervals used in previous studies, inorder to assess long-term graft survival. NOTE: It is possible tocounteGFP-positivephotoreceptorsfollowingtransplantationfromthe Rho-eGFP-negative pool, despite the fact that re-analysis of theFACS pool immediately post-sorting indicates that it is indeed 99%negative. The presence of positive cells in the recipient retina 3months later occurs as a result of the fact that rhodopsin isincreasingly expressed in rod photoreceptors as rod cells mature.We have found that some cells that were Rho-eGFP negative at the  Table 1 Primer sequences for PCR.18Smm F: GTAACCCGTTGAACCCCATT18Smm R: CCATCCAATCGGTAGTAGCGGapdh F: ACCACAGTCCATGCCATCACGapdh R: TCCACCACCCTGTTGCTGTAB-actin F: CGTGGGCCGCCCTAGGCACCAB-actin R: TTGGCCTTAGGGTTCAGGGGGBrn3b F: TGGTGCTTACTCTGCTGGATTCTBrn 3b R: CCTATTTGTGTGTGTGCTCCAARpf1 F: CCTACCACAGGAAGCCCAAGRpf1 R: TGGATGGCTCACTCCCAATAAThy1 F: CCTGTAGTGAGGGTGGCAGAThy1 R: GGATCAGGGACAGCAAGAGGIsl1 F: CACAGAGCGGAAGAAACCAGIsl1 R: GGGAGGAGAGGCAAACGTAAAtoh7 F: CCAGGACAAGAAGCTGTCCAAAtoh7 R: CCCATAGGGCTCAGGGTCTABsn F: ATCCCTGGCCCTTATGTTGABsn R: GTTCACCCTGCCCAAAGAACNr2e3 F: TTGGGAAATTGCTCCTCCTGNr2e3 R: CCTGTGGACACTTGGCACTCArr3 F: CTGGATGGCAAACTCAAGCAArr3 R: AGGAGATGGCTTTGGATGGACcnD1 F: TCTGCTTGACTTTCCCAACCCcnD1 R: TGGTCCCACCTTCACCTCTTmKi67 F: CAACCATCCAGGGAAACCAGmKi67 R: GGCATCTGTGTGGGTCCTTTTh F: TTCGAGGAGAGGGATGGAAATh R: CGACGCACAGAACTGAGGAGChAT F: TCTGCTGTTATGGCCCTGTGChAT R: AGATTGCTTGGCTTGGTTGGGad1 F: AAGCAACTACAGGGCGGATGGad1 R: GGGTACTAACAGGGAGGGTGTGGabbr1 F: TGTGTGTGTGTTGCCCTGACGabbr1 R: CAAAGTGGGACGCATGAGAASyp F: ATGGTTGGGAGCTGTGAGGTSyp R: AGGGAGAGGGCAGAGAAAGGOct4 F: GAGCACGAGTGGAAAGCAACOct4 R: CGCCGGTTACAGAACCATACBrachyury F: CATGTACTCTTTCTTGCTGGBrachyury R: GGTCTCGGGAAAGCAGTGGCKDR F: TTTGGCAAATACAACCCTTCAGAKDR R: GCAGAAGATACTGTCACCACCFgf5 F: TGTGTCTCAGGGGATTGTAGGFgf5 R: AGCTGTTTTCTTGGAATCTCTCCGscF: CAGATGCTGCCCTACATGAACGscR: TCTGGGTACTTCGTCTCCTGGNodal F: TTCAAGCCTGTTGGGCTCTACNodal R: TCCGGTCACGTCCACATCTTMash1 F: CCACGGTCTTTGCTTCTGTTTMash1 R: TGGGGATGGCAGTTGTAAGAGfap F: AAAACCGCATCACCATTCCTGfap R: ACGTCCTTGTGCTCCTGCTTDcx F: GGCCAAGAGTTTCTGCCAAGDcx R: TAATGCAGGGATCAGGGACANest F: ATGGGAGGATGGAGAATGGANest R: GTGCCAGAGGGGCAGTTTCTChx10 F: AAGGAGCCATGTTGGACTGAAChx10 R: GCCTGGGAATACAGGAGCAGSox2 F: CTAGACTCCGGGCGATGAAASox2 R: TGCCTTAAACAAGACCACGAAAOtx2 F: GGTCCATCAACCAGCAACCTOtx2 R: ACACCGGATCACCTCTGCTTPax 6 F: GAGAAATGGCGGTTAGAAGCAPax 6 R: CAACCACATGAGCAACACAGAMitf F: GATGGACGATGCCCTCTCACMitf R: CTGGGCTACTGATAAAGCACGAAmGluR6 F: CCGTGAATTGTCTTGTTGCTGmGluR6 R: CCACCTTTCATGTTGGTGCTCnga1 F: TTGGGAGAAAGAGTCGTCTGGCnga1 R: GAACATCGGTGGGGAAGAAACrx F: CTCCAGACACACCAGGAAAGGCrx R: GTGGGAGTGCAACAGGGTTTNrl F: CAGCAGTTGATTGTTTGCCTAATCNrl R: TGAGACCTGGAGGACAGCTACARecov F: CAGAAAAGCGGGCTGAGAAGRecov R: TTACCCAGCAATCCCCAAAGRho F: TGTGGGGACAAACAGTCCAGRho R: GGCTCCATCCCATTCTTTTG Q-PCR HPLC puri   ed primers Qactin F: CCACCATGTACCCAGGCATTQactin R: ACAGTGAGGCCAGGATGGAGQNrl F: ATGCAAGTGGATTGGAGGAGQNrl R: CATGGCAACTGTGAGACCTGQCrx F: TCTTCCGTAAAGGTGCTGAGAQCrx R: TGCTGGGATTATGACCATTGAQRho F: CTGAGGGCATGCAATGTTCAQRho R: CATAGCAGAAGAAGATGACG F.C. Mansergh et al. / Experimental Eye Research 91 (2010) 500 e 512  503  point of FACS analysis at PN3 e 5 go on to express rhodopsin later(andthereforealsotheRho-eGFPfusionprotein).Thesecanthenbevisualized when counting. Indeed, the purpose of this experimentwas to determine whether the Rho-eGFP-positive cells that end upwith photoreceptor morphology post-transplantation were pre-speci  ed as rods (and therefore Rho-eGFP þ ve) at PN3 e 5 orwhether the rod speci  cation came later, after transplantation of cells that were Rho-eGFP negative at the point of FACS sorting, butbecame Rho-eGFP positive after transplantation. Our   ndingsindicatetheformertobethecase,butnotexclusivelyso;someRho-eGFP-positive photoreceptor morphology is obtained after trans-plantation of cells that are Rho-eGFP negative at PN3 e 5.At both PN3 and PN5, Rho-eGFP positive, sorted cells integratedat a higher frequency than Rho-eGFP-negative sorted cells and thisdifference was more signi  cant in PN5 cells than PN3. t-Tests gavevalues of p ¼ 0.165 for PN3, p ¼ 0.050 for PN5, and p ¼ 0.014 forboth data sets combined (Fig. 1). Integration rates are lower thanthe 0.6% value reported previously (MacLaren et al., 2006; Bartschet al., 2008), probably as a result of negative impacts on cellsurvival of harsh enzymatic digestion followed by FACS analysis, orthe longer period of time elapsed between injection and sacri  ce.We conclude that rhodopsin expression is a marker of the ability of primary retinal cells to form photoreceptors post-transplantation.  3.2. Transplantation of cultured RPCs In contrast, transplantation of cultured RPCs resulted in lowerpercentages of integrated cells and no photoreceptor morphology.Multiple injections of proliferating and differentiatedRPCs, passages1 e 3, derived from PN2 e 5 eGFP transgenic mice, were transplantedinto2 e 6montholdC57Bl/6Jrecipients.Weusedlowerpassagecellsas there is evidence that karyotypic instabilitycan occur in neonatalRPCs after passage 9 (Djojosubroto et al., 2009). Transplanted RPCssurvived inthe retina ata rate of 0.022%, while integratedcells wereonly 0.005% of cells transplanted initially. None gave photoreceptormorphology (Fig. 1). This contrasts with approximately 0.2% cellswith photoreceptor morphology for freshly dissociated retinal cells(see Fig. 1A, B). No consistent differences in survival or integrationratesbetweenproliferatinganddifferentiatedRPCswerenoted;bothwere uniformly low. Integration occurs primarily in the inner plexi-formand ganglion cell layers; a majorityofintegratedcells are GFAPpositive (Fig.1C e E).  3.3. Optimisation of cell culture conditions Previous protocols resulted in high cell death rates in the   rstfew days following initial plating of dissociated cells. In order toobtain con  uent cells from RPCs within 3 e 4 weeks, platingdensities of 1 e 2  10 5 cells/cm 2 had been used (2.5 e 5 million cellsper T25). Existing protocols recommend the digestion of retinas for10 e 20 minintrypsin,collagenase,hyaluronidase,kynerunicacidorcombinationsthereof(Klassenetal.,2004;Canolaetal.,2007).Thisresults in a single cell suspension, however, the effect on the cellsmay be excessively harsh, given the levels of cell death.Previously we had incubated retinas with trypsin for 20min at37   C,withadditionofDNase1after5 minandtrypsininhibitorafter20min. Samples were triturated using a p1000 pipette, spun andresuspended in growth medium. This protocol yields a single cellsuspension and requires plating of a minimum 1  10 5 cells/cm 2 .Growth to 80 e 90% con  uence takes a month, and at minimum celldensity, a majority of cultures do not survive.We then tried 10   dilutions of Accutase and tissue cultureformulatedtrypsin/EDTAtodigesttheretinasfor5 e 10min,followedby dissociation with a   re polished and narrowed borosilicate glasspipette. Some samples were dissociated mechanically without anyenzymatic digestion. Comparison of the numbers of resulting cellsgained by these methods gave a p value of 0.027, which underesti-mates the signi  cance of this result; of 12 cultures plated using theold method, only 4 survived to be included in data processing. Allcultures plated using minimal digestion or mechanical dissociationalone survived (Fig. 2A). Furthermore, with optimized tissue cultureconditions (see below), plating densities of 100,000 cells per T25(4  10 3 cells/cm 2 ) will reliably give rise to cultures within 10 e 20days (Fig. 2B). Growth times from initial plating to 80 e 90% con  u-ence varied between 19.3 days for 100,000 cells to 10.75 days for 1.5millioncellsperT25.Differencesintherateofcelldivisioncausedbyinitial cell density are not statistically signi  cant.We also tested the growth rates of RPCs derived from differentmouse strains (Fig. 2C), in order to verify that the cells being trans-planted (eGFP, Rho-eGFP) did not behave differently fromwild-typecells. We tested rhodopsin knockout derived PN3 e 4 cells (Rho  /  ,Humphries et al.,1997), to determine whether lower percentages of photoreceptor precursors would in  uence growth rates; photore-ceptors in these mice start to degenerate from birth. Differences inthe rate of cell division (increase in cell #/day) caused by straindifference, genetic modi  cation or the presence of eGFP are notstatistically signi  cant. Notably, RPC growth is not in  uenced by theabsence of functional rhodopsin expression, since rhodopsinknockout cells grew at indistinguishable rates from wild type.  3.4. Cell culture media and supplements Initial protocols used DMEM/F12 medium with 1% pen-icillin e streptomycin and L-glutamine, supplementedwith N2, FGF2,EGF and heparin. We decided to test the effect of replacing N2supplement with B27 supplement, or B27 minus Vitamin A (alsoknownasretinoicacid,RA).RAisapotentmorphogenandisusedtoeffect neural differentiation in ES cells (Bain et al.,1995). Derivativesof RA (all-trans-retinol and 11-cis-retinal) are vital components inthe visual transduction cycle. We reasoned that B27  RA mightbettersupportproliferationofstemcellsandpreventdifferentiation,allowingbettergrowthinculture.Wealsotestedtheadditionoffetalcalf serum (FCS), which is known to bias neural stem cells towardsa glial cell fate, but which often promotes cell survival. Finally,DMEM/F12 was replaced variously with neurobasal medium, post-natal neural stem cell medium or embryonic neural stem cellmedium(Sigma).Ineachcase,mediaweresupplementedwithN2orB27, with EGF, FGF2 and heparin as usual (Fig. 2D).Postnatal and embryonic stem cell media did not support thegrowth of RPCs. Neurobasal medium permitted growth, but ataslowerratethanwithDMEM/F12.Intermsofincreasedsurvivalandgrowth, DMEM/F12 with B27  RAwere by far the bestcombination(N2 vs B27  RA; p ¼ 0.0062). Predictably, B27 þ RA slowed growthin comparison to N2 supplemented media and increased the likeli-hood of spontaneous differentiation. Addition of FCS caused a rapidmorphological transition such that   at   broblast type cells wereobserved after a number of days; subsequent passages resulted ina decrease in cell number. We also tested various combinations of N2B27, N2B27  RA, and N2B27 where BSA had been omitted fromthe N2 supplement. None were superior to B27  RA alone.  3.5. Cell attachment  We tested the in  uence of cell attachment on growth. Neuralstem cells can be grown as neurospheres, which contain mixturesof differentiated and undifferentiated cells. However, RPCs showa strong preference forattachmenttotissue culture  asks and eventend toattach tobacterial Petri-dishes. Concernwas expressed thatattached cells may be biased towards a glial lineage and growth asa monolayer maypreclude the culture of photoreceptor precursors. F.C. Mansergh et al. / Experimental Eye Research 91 (2010) 500 e 512 504
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks