Design

PCR amplification of the Irish potato famine pathogen from historic specimens

Description
PCR amplification of the Irish potato famine pathogen from historic specimens
Categories
Published
of 3
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ©    2001 Macmillan Magazines Ltd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                100 bpHerbarium samples    M  y  c  +   L  e  a   f  –   L  e  a   f   N   T 12345678910111213141516                                                                                 167 bp b Msp 1   I s o  l a  t e  H a  p  l o  t  y  p e   D a  t e restriction site 93-3 Ia 1993 AATTTCTCCAACAAAACTACTTGAACCTGGAATAGACATATTTGCTAATACATAAATAAA188.1.1 Ib 1996 AATTTCTCCAACAAAACTACTTGAACCCGGAATAGACATATTTGCTAATACATAAATAAA18-94 IIa 1996 AATTTCTCCAACAAAACTACTTGAACCTGGAATAGACATATTTGCTAATACATAAATAAA94-52 IIb 1994 AATTTCTCCAACAAAACTACTTGAACCTGGAATAGACATATTTGCTAATACATAAATAAA Herbarium specimenNumberDate 6 1847 AATTTCTCCAACAAAA-T-CTT-AACCTGGAATAGACATATTTGCTAATACATAAATAAA22 1875 AATTTCTCCAACAAAACTACTTGAACCTGGAATAGACATATTTGCTAATACATAAATAAA33 1886 AATTTCTCCAACAAAACTACTTGAACCTGGAATAGACATATTTGCTAATACATAAATAAA31 1884 NATTTCTCCACC-NAANTT-TTGAACCTGGAATAGACATATTTGCTAATACATAAATAAA186882 1902 AATTTCTCC-ACA---CC-CTTGAAC---G-ATTGACATAT-TGCTAAT-CAT--ATAAA186890 1906 AATTTCT-CNAC-AA-CC-CTTGANCCTGGAATAGACATATTTGCTNATACATAAATAAA186875 1916 AATTTCTCCAACA-AACTAC-TGNACNTGGNAT-GACATATTTGCTAATACATAAATAAA186864 1919 AATTTCT-C-AC-AAACTACTT-AACCTNGAAT-GACATATT--CTA--NCAT-N-T-AA186869 1922 AATTTCTCCN-CAAAA-A-CTTGAACCTGGAATAGACATATTTGCTAATACATAAATAAA186872 1928 AATTTCTCCAACAAAACTACTTGAACCTGGAATAGACATATTTGCTAATACATAAATAAA ****** * * * * * ** ******* ** *** * ** a Herbarium samples    M  y  c  +   L  e  a   f  –   L  e  a   f   N   T 123456789101112                                                                                                                                        ©    2001 Macmillan Magazines Ltd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ©    2001 Macmillan Magazines Ltd
Search
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x