Gadgets

Report of a parasitic wasp (Hymenoptera: Encyrtidae) parasitizing cotton mealybug (Hemiptera: Pseudococcidae) in Pakistan and use of PCR for estimating parasitism levels

Description
Report of a parasitic wasp (Hymenoptera: Encyrtidae) parasitizing cotton mealybug (Hemiptera: Pseudococcidae) in Pakistan and use of PCR for estimating parasitism levels
Categories
Published
of 6
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  SHORT COMMUNICATIONReport of a parasitic wasp (Hymenoptera: Encyrtidae) parasitizingcotton mealybug (Hemiptera: Pseudococcidae) in Pakistan and use of PCR for estimating parasitism levels Muhammad Ashfaq a *, Ghulam Shabbir Shah b , Ali Raza Noor a ,Shahida Parveen Ansari b and Shahid Mansoor a a National Institute for Biotechnology and Genetic Engineering, PO Box 577 Jhang Road, Faisalabad, Pakistan;  b Entomological Section, Agricultural Research Institute,Tando Jam, Pakistan ( Received 16 November 2009; returned 13 January 2010; accepted 10 February 2010 )A parasitic wasp,  Aenasius bambawalei  , was studied for its biological parametersand parasitism levels in the cotton mealybug ( Phenacoccus solenopsis ). Biologicalparameters including parasitism efficiency, time to pupation, time to eclosion andadult sex ratio were studied under lab conditions. Parasitism levels in fieldcollected mealybug were determined using PCR. Results showed an increase inparasitism over the study period, with higher parasitism levels in 2009 comparedto the preceding 2 years. Keywords:  Aenasius ; mealybug; Pakistan; parasitism; PCR Cotton mealybug has appeared as a major insect pest of cotton crop in Pakistan.Since its appearance in 2005, the pest has been causing significant crop losses. Themealybug species in Pakistan has been indentified as  Phenacoccus solenopsis  Tinsley(Hodgson, Abbas, Arif, and Saeed 2008), a species previously not reported from thispart of the world. Recently, an endo-parasitic wasp that is considered to be a newspecies, has been identified parasitizing cotton mealybug. The parasitoid has beennamed  Aenasius bambawalei   (Hymenoptera: Encyrtidae) (Hayat 2009). Wasps fromthe family Encyrtidae have been documented as potent parasitoids of mealybugs andare known to play a role in biological control of several mealybug species (Bertschy,Turlings, Bellotti, and Silvia 2000; Dorn, Mattiacci, Anthony, Bellotti, and Dorn2001). For example,  Aenasius vexans  and  Acerophagus coccois  have been usedsuccessfully for the biological control of cassava mealybug in Venezuela (Bento et al.1999). Information about biology, correct host/parasitoid species identification andparasitism efficiency of the newly introduced or native parasitoids has always beendesired to devise and implement a successful biological control program. Hostdissections and rearing have been used for identifying parasitoid species and makingparasitism estimates but these methods have their own limitations (Day 1994).Difficulty in identifying the nymphal stages of mealybugs (Miller 2002) and the lackof distinguishing taxonomic characters of parasitoid larvae further hamper host andparasitoid identification. *Corresponding author. Email: ashfaqm@nibge.org or muhammadashfaq@hotmail.com Biocontrol Science and Technology, Vol. 20, No. 6, 2010, 625    630 ISSN 0958-3157 print/ISSN 1360-0478 online # 2010 Taylor & FrancisDOI: 10.1080/09583151003693535http://www.informaworld.com  D o w n  l o a  d e  d B y :  [ P E R I P a  k  i s t a n  ] A t : 1 0 : 4 2 2 9 M a r c  h 2 0 1 0  Polymerase chain reaction (PCR) has been used as a tool to differentiate betweeninsect species based on the difference in their DNA sequences (Heckel 2003).Diagnostic molecular markers are in fact being used to study host    parasitoidrelationships in biological control programs and haveproved superior to conventionalmethods such as host rearing and dissection (Ashfaq, Braun, Hegedus, andErlandson2004; Gariepy, Kuhlmann, Gillott, and Erlandson 2007, 2008). For example, Tilmon,Danforth, Day, and Hoffmann (2000) and Ashfaq, Erlandson, and Braun (2005) usedDNA from the  Lygus  sp. hosts to detect the presence and species of a parasitoid, Peristenus  sp. and a hyperparasitoid,  Mesochorus  sp. respectively, inside the host body.Thetechniquewaseffectiveinestimatingparasitismlevelsof  Peristenuspallipes infieldcollected nymphs of   Lygus  spp. and making comparisons in parasitism levels betweenhost rearing and dissections (Ashfaq et al. 2004). In the current study we haveinvestigated the parasitism efficiency and biological parameters of a cotton mealybugparasitoid species under lab conditions and estimated parasitism levels in fieldcollected mealybug specimens using PCR. Biological studies The cotton mealybug remains active on cotton in Pakistan throughout the croppingseason, with severe damage from April to August. Biological studies of the parasitoid, A. bambawalei   were conducted from May 14 through June 2, 2009 in the laboratory. Amealybug colony was maintained in parasitoid-free cageswith controlled temperature(28 8 C) and humidity (70% RH). Parasitized mealybug/mummies were collected fromnearby cotton fields and reared in plastic jars to obtain virgin adults. Unparasitizedthird instar mealybug nymphs (L3) and adults in equal numbers (15 each) were placedin glass Petri plates. Single freshly emerged female and male wasps were introduced inthe mealybug containing Petri plate. The wasp pair was removed from the plate after24 h and introduced to a fresh plate. Parasitoid exposed adult mealybug and L3nymphs were separated into new plates, provided with fresh cotton leaves, and rearedtomummyformation.Thisprocesswasrepeatedevery24huntilthefemalewaspdied.The procedure was conducted using four independent wasp pairs on the same dates.Data on the number of mealybug mummies formed in the plates, date of mummyformation, number and date of adult emergence and number of males and femalesamong emerging adults were recorded. Analysis of variance of recorded parameterswas performed and means were compared using the Tukey    Kramer test. Parasitismefficiency over time was judged by number of mealybug mummies formed on eachexposure date and the trend was analyzed by regression analysis. PCR and cloning of COI from  A. bambawalei  DNAwas extracted from individual parasitoid adults as described earlier (Erlandsonetal.2003)andusedinPCRreactionswhereapplicable.AfragmentoftheCOIgeneof the parasitoid was amplified using primer pair TL2-N-3014 and C1-J-2195 (Simonet al. 1994) in a 50- m L PCR reaction. Resulting PCR product (860 bp) was cloned(InsTAclone PCR Cloning Kit, Fermentas, Inc., USA) and subsequently sequenced.The sequence obtained was analyzed using bioinformatics tools for the sequenceverification and is available in the DDBJ/EMBL/GenBank databases under accessionnumberAB521131.TheobtainedCOIsequenceoftheparasitoidwasalignedwiththat626  M. Ashfaq  et al .  D o w n  l o a  d e  d B y :  [ P E R I P a  k  i s t a n  ] A t : 1 0 : 4 2 2 9 M a r c  h 2 0 1 0  of cotton mealybug to identify the nucleotide sequence variability suitable fordesigning parasitoid-specific primers. The COI from cotton mealybug has beensequenced by our lab and is available under accession no. AB499696. A new pair of parasitoid-specific primers, AenF1 (GTTTCTCACATAATTTGTAG) and AenR1(CCTCGGAGGATAAAAAGAC) was designed to amplify a 744-bp fragment of COI from parasitoid and was optimized for diagnostic PCR. Estimation of parasitism levels by diagnostic PCR Cotton fields at seven to 10 predetermined localities in Sindh and Punjab provinceswerevisited once a month during April through August 2007 to 2009. Threemealybuginfested leaves from five visibly attacked cotton plants from each locality weredetached and brought to the lab in plastic bags. Insects were removed from the leavesby shaking and stored at  20 8 C prior to use. Adults and L3 nymphs were randomlypickedfromeachyear’scollectionandusedindividuallyinadiagnosticPCR.PCRwasperformedina50- m LreactionwithprimerpairAenF1andAenR1using1 m LofDNAand following the profile 94 8 C, 2 min; 94 8 C 30 s, 58 8 C 1.5 min, 72 8 C 2 min (35 cycles);72 8 C 5 min. PCR products were separated on 1.2% agarose gels, ethidium bromidestainedandDNAbandswerevisualizedunderUVillumination.AsinglePCRbandof 744 bp on the gel was counted as a parasitized mealybug specimen.After 24 h of mealybug exposure to a parasitoid, 60% of the combined nymphaland adult mealybugs formed mummies (resulting from parasitoid pupation). Mummyformation did not differ significantly when both the groups (L3 and adults) wereanalyzed separately. Eighty-five percent of the pupae hatched to adults and two-thirdsof the emerging adults were females. Members of the genus  Aenasius  are generallysolitary but efficient parasitoids, as in a study by Dorn et al. (2001) who found that A. vexans  parasitized more host insects than a gregarious  Acerophagus coccois (Encyrtidae). In another study Bertschy et al. (2000) suggested that for oviposition A. vexans  preferred later instars and adults, and later the developmental stage of thehost at oviposition the faster the parasitoid developed and emerged. And that the A. vexans  adults emerging from third instars and adult mealybug were predominantlyfemale compared to adults emerging from early instars. In our studies male:femaleratio of emerging adults was 1:2. In a separate analysis, days after exposure (DAE) toparasitism were compared for the mummy formation, an indicator of developmentaltime from oviposition to pupation. Mummy formation was initiated 5 DAE andcontinued until 9 DAE. A significantly ( P  B 0.05) higher number of mummies wereformed on days 5 and 6 compared to other time periods (Figure 1, left hand bars).Adulteclosionstarted11DAEandcontinueduntil 13DAE. Theresultsshowedthatasignificantly higher numberof adults emerged on day 11 as compared to the followingdays (Figure 1, right hand bars). A relationship between parasitism efficiency and ageof the parasitoid adults was determined through regression analysis. Age (in days) of parasitoidwas plotted against the percent mummies formed in the plate the parasitoidwas introduced into. Age of the freshly emerged adultswas denoted ‘0’ and so on. Theregression line showed a significant reduction in parasitism with an increase in the ageof parasitoid (Figure 2). Previously, Bertschy et al. (2000) in their studies on  A. vexans have found that during the first 5 days after emergence the parasitoid parasitized thegreatest number of mealybug hosts. Biocontrol Science and Technology  627  D o w n  l o a  d e  d B y :  [ P E R I P a  k  i s t a n  ] A t : 1 0 : 4 2 2 9 M a r c  h 2 0 1 0  An 860-bp PCR fragment of the COI gene from the parasitoid was amplified andsequenced. The blast search (NCBI) revealed a 90% nucleotide identity to that of  Aenasius bolowi  . Diagnostic PCR was used to detect parasitism in mealybugspecimens collected from the field over a period of 3 years. A 744-bp PCR productwas amplified where a mealybug specimen was parasitized (data not shown). PCRbased estimations showed that parasitism levels were 10% ( n  40), 48% ( n  44) and52% ( n  75) in the year 2007, 2008 and 2009, respectively. The use of PCR for aa b bcca bc 05101520253035404550d5 d6 d7 d8 d9 d11 d12 d13 Mummies formed over timeAdults emerged overtime    P  e  r  c  e  n   t  a  g  e Figure 1. Developmental time to pupation (mummy formation) and adult emergence of  A. bambawalei  . Numbers on  X  -axis represent the days after exposure of   P. solenopsis  toparasitoid. Same color bars on left hand indicate the mummies formed and bars on right handindicate the adults emerged. Different letters on top of bars in each group show the significantdifferences ( P  B 0.05). 01020304050607080901000 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Age of parasitoid (days)    P  e  r  c  e  n   t  p  a  r  a  s   i   t   i  s  m R  2  = 0.8673 Figure 2. Parasitism efficiency plotted against age of the parasitoid,  A. bambawalei  . Percentparasitism is based on the number of mummies formed among  P. solenopsis  individualsexposed to parasitism at a certain age of the parasitoid. Each number on  X  -axis shows the ageof parasitoid and the relative point on  Y  -axis shows the number of mummies formed among P. solenopsis  individuals exposed to parasitoid at that age. 628  M. Ashfaq  et al .  D o w n  l o a  d e  d B y :  [ P E R I P a  k  i s t a n  ] A t : 1 0 : 4 2 2 9 M a r c  h 2 0 1 0  estimating parasitism levels in host populations is increasing (Gariepy et al. 2007).When comparisons were made in levels of   P. pallipes  parasitism between the PCRmethod, host rearing and host dissections from field collected  Lygus  sp. populations,PCR gave better estimates (Ashfaq et al. 2004). However, we cannot compare ourhost rearing results with PCR as the exposure for rearing was conducted in the lab,whereas PCR studies were conducted on field collected insects.  P. solenopsis  is knownto be an invasive species which was first observed in 2005 in this region. Thepopulation buildup of this pest reached the highest level in 2007. The possibility thatthe parasitoid  A. bambawalei   in this region came with  P. solenopsis  cannot be ruledout. A population buildup of the parasitoid following the population buildup of mealybug host is very likely as the PCR based parasitism estimates show an increaseover the years. These studies need to be expanded by including more parameters onbiological studies and more samples from different geographic areas and fromalternate host plants for diagnostic PCR. Acknowledgements A support grant from the Ministry of Food and Agriculture and Higher EducationCommission (HEC) Pakistan for these studies is acknowledged. Muhammad Ashfaq isthankful to HEC for providing support under the Foreign Faculty Hiring Program. References Ashfaq, M., Braun, L., Hegedus, D., and Erlandson, M. (2004), ‘Estimating Parasitism Levelsin  Lygus  spp. (Hemiptera: Miridae) Field Populations Using Standard and MolecularTechniques’,  Biocontrol Science and Technology , 14, 731    735.Ashfaq, M., Erlandson, M., and Braun, L. (2005), ‘Hyperparasitism by  Mesochorus  spp.(Hymenoptera: Ichneumonidae) in  Peristenus  sp. (Hymenoptera: Braconidae) and Devel-opment of PCR Primers for Hyperparasitoid Detection’,  Biological Control  , 32, 371    377.Bento, J.M.S., de Moraes, G.J., Bellotti, A.C., Castillo, J.A., Warumby, J.F., and Lapointe, S.L.(1999), ‘Introduction of Parasitoids for the Control of the Cassava Mealybug  Phenacoccusherreni   (Hemiptera: Pseudococcidae) in North-Eastern Brazil’,  Bulletin of Entomological Research , 89, 403    410.Bertschy, C., Turlings, T.C.J., Bellotti, A., and Silvia, D. (2000), ‘Host Stage Preference andSex Allocation in  Aenasius vexans , an Encyrtid Parasitoid of the Cassava Mealybug’, Entomologia Experimentalis et Applicata , 95, 283    291.Day, W.H. (1994), ‘Estimating Mortality Caused by Parasites and Diseases of Insects:Comparisons of the Dissection and Rearing Methods’,  Environmental Entomology , 23,543    550.Dorn, B., Mattiacci, L., Anthony, C., Bellotti, A.C., and Dorn, C. (2001), ‘Host Specificityand Comparative Foraging Behaviour of   Aenasius vexans  and  Acerophagus coccois , TwoEndo-parasitoids of the Cassava Mealybug’,  Entomologia Experimentalis et Applicata , 99,331    339.Erlandson, M., Braun, L., Baldwin, D., Soroka, J., Ashfaq, M., and Hegedus, D. (2003),‘Molecular Markers for  Peristenus  spp. (Hymenoptera: Braconidae) Parasitoids Associatedwith  Lygus  spp. (Hemiptera: Miridae)’,  Canadian Entomologist , 135, 71    83.Gariepy, T.D., Kuhlmann, U., Gillott, C., and Erlandson, M. (2007), ‘Parasitoids, Predatorsand PCR: The Use of Diagnostic Molecular Markers in Biological Control of Arthropods’, Journal of Applied Entomology , 131, 225    240.Gariepy, T.D., Kuhlmann, U., Gillott, C., and Erlandson, M. (2008), ‘A Large-scaleComparison of Conventional and Molecular Methods for the Evaluation of Host    Parasitoid Associations in Non-target Risk-Assessment Studies’,  Journal of Applied Ecology , 45, 708    715. Biocontrol Science and Technology  629  D o w n  l o a  d e  d B y :  [ P E R I P a  k  i s t a n  ] A t : 1 0 : 4 2 2 9 M a r c  h 2 0 1 0

Barco

Jan 13, 2019
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks