Funny & Jokes

A cyclo peptide activates signaling events and promotes growth and the production of the bone matrix

Description
A cyclo peptide activates signaling events and promotes growth and the production of the bone matrix
Categories
Published
of 9
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Peptides 24 (2003) 1349–1357 A cyclo peptide activates signaling events and promotesgrowth and the production of the bone matrix S. Pallu a , R. Bareille a , M. Dard b , H. Kessler c , A. Jonczyk  d ,M. Vernizeau e , J. Amédée-Vilamitjana a , ∗ a  INSERM U.577, Université Bordeaux Victor Segalen, Bordeaux 2, 33076 Bordeaux Cedex, France b  Biomet—Merck Biomaterials, R/D, D64271 Darmstadt, Germany c  Institut für Organische Chemie und Biochemie, Technische Universität Munich, 85747 Garching, Germany d  Merck KGaAPreclinical Research, 64271 Darmstadt, Germany e  Biomet-Merck France, Valence, France Received 29 May 2003; accepted 12 September 2003 Abstract The interaction of bone cells and their underlying extracellular matrix impacts biological processes such as maintenance of tissueintegrity. The biological recognition of the extracellular matrix by attached cells is mediated by the activity of integrins that recognizeadhesive-specific domains. The most widely recognized adhesive motif is the RGD sequence, common to many of the adhesive matrixmolecules. Here, we show that cyclo DFKRG which was previously selected to increase cell adhesion of human bone marrow stromal cells(HBMSC), increases both cell differentiation and mineralization through activation of tyrosine kinases, focal adhesion kinase (p 125 FAK)and Mitogen Activated Protein (MAP) kinases.© 2003 Elsevier Inc. All rights reserved. Keywords:  Adhesion; RGD-peptide; Integrins; FAK; MAPK; Phosphorylation; Mineralization 1. Introduction The interaction of bone cells and their underlying extra-cellular matrix impacts biological processes such as boneremodeling, wound healing, maintenance of tissue integrityand also cancer metastasis [9].The biological recognition of the extracellular matrix byattached cells is mediated by the activity of cell-surface re-ceptorssuchasintegrinsthatrecognizeadhesive-specificdo-mains on extracellular matrix proteins [2]. The most widelyrecognized adhesive motif is the RGD sequence, common tomany of the adhesive matrix molecules such as fibronectin,osteopontin, type I collagen. Modification of the amino acidsequences flanking the RGD motif or changing its three-dimensional structure has been shown to modify the affin-ity between integrins and ligand [15,19]. Cyclo RGD pep- tides can interact with integrins more effectively than canlinear RGD peptides because the cyclization induces con- ∗ Corresponding author. Tel.:  + 33-557-571737; fax:  + 33-556-900517.  E-mail address:  joelle.amedee@bordeaux.inserm.fr(J. Am´ed´ee-Vilamitjana). formational stability as well as enhances the preferred three-dimensional structure for receptor interactions [3,10].In our previous study [23] we bound different cy-clo or linear peptides through a sulfosuccinimidyl-4-  p -maleimidophenyl-butyrate (SMPB) cross-linker to surfacescoated with bovine serum albumin (BSA). We have shownthat cyclo DFKRG are potential activators of adhesion of human osteogenic cells arising from bone marrow [23].Binding of these adhesive motifs to surfaces provides toolsto the understanding of signaling pathways involved in thisinteraction that control cell morphology, cell proliferation,differentiation or apoptosis [8].Integrin-mediated adhesion is a complex cascade of bio-chemical and biomechanical events including recruitmentand reorganization of cytoskeletal components (vinculin,talin) and signaling molecules like focal adhesion kinase(p 125 FAK), ras and src [5,14] and MAPK (Erk 1/2, p38, etc.) [6,11].In the present paper, we show that the cyclo peptide stimu-lates protein tyrosine kinases, increases the phosphorylationof p 125 FAK and activates mitogen activated protein (MAP)kinases. Furthermore, these related phenomena are associ-ated with an increase of bone-specific markers, i.e. osteocal- 0196-9781/$ – see front matter © 2003 Elsevier Inc. All rights reserved.doi:10.1016/j.peptides.2003.09.003  1350  S. Pallu et al./Peptides 24 (2003) 1349–1357  cin and mineralization process. These data suggest that thiscyclo peptide should constitute a good candidate to promotenot only cell adhesion but also the ingrowth and the produc-tion of a bone-specific matrix once grafted onto a function-alized material. 2. Experimental procedures 2.1. Materials Cyclo DFKRG and RAFK were from Biomet—Merck Biomaterials R&D [23]. 2.2. Cell culture Osteoprogenitor cells were isolated from human bonemarrow stromal cells (HBMSC) according to Vilamitjana-Amédée et al. [24] with some modifications. Cells werecultured in Iscove modified Dulbecco’s medium (IMDM,GIBCO) supplemented with 10% (v/v) fetal calf serum(FCS, GIBCO) and 10 − 8 M dexamethasone (SIGMA) for3 weeks and thereafter in the same dexamethasone-freemedium. Cell differentiation was followed by the mea-surement of osteocalcin expression or alkaline phosphataseactivity as described previously [24]. 2.3. RT-PCR analysis Total RNA was extracted using RNeasy total RNA kit(QIAGEN) and 2  g were used as template for cDNA syn-thesis using Superscript Preamplification System (GIBCO,BRL) according to the supplier instructions. After the re-verse transcriptase step, cDNA samples were mixed witha PCR cocktail: 20mM Tris–HCl pH 8.4, 50mM KCl,2.5mM MgCl 2 , 0.1mg/ml BSA, 0.5mM of dNTP, 2.5U of Taq polymerase, and 0.5mM each of forward and reverseprimers (Osteocalcin: sense sequence 5 ′ –3 ′ : ATGAGAGC-CCTCACACTCCTC; antisense sequence 5 ′ –3 ′ : CTAGAC-CGGGCCGTAGAAGCG;   -actin: sense sequence 5 ′ –3 ′ :GTGGGGCGCCCCAGGCACCA; antisense sequence5 ′ –3 ′ : CTCCTTAATGTCACGCACGAT) in 50  l final vol-ume. Samples were transferred into a programmable thermalcycler (HYBAID) that had preheated to 94 ◦ C and incu-bated for 30 cycles. Each cycle consisted in a denaturationstep (94 ◦ C for 5min), an annealing step at the optimizedhybridization temperature ( T  m : 51 ◦ C), and an extensionstep (72 ◦ C for 30s). PCR products were separated by elec-trophoresis on a 1% (w/v) agarose gel and visualized byethidium bromide staining with UV light illumination. 2.4. Quantification of osteocalcin cDNA by competitivePCR A mutated osteocalcin (OC) cDNA was made using re-striction site directed mutagenesis (Transformer Site Di-rected Mutagenesis Kit, Clonech Laboratories Promega).This mutagenesis introduces an  Xho I site in place of   Bam H1site. Mutant OC cDNA has been cloned in the plasmidpGEMt (PROMEGA). For competitive PCR [1], cDNA was co-amplified with different amounts of mutant OC cDNA(1–150pg). PCR products were digested with  Xho I and runon a 2% (w/v) agarose gel. Densitometric analysis was per-formed onto each band using NIH Image 1.62, the band in-tensity data were converted to ratio of OC cDNA to mutantcDNA and were plotted against the amount of mutant OCcDNA added in each assay. Amplification of    -actin wasused as a control to check the efficiency of the reverse tran-scriptase reaction and subsequent PCR. 2.5. RGD-containing peptide coating procedures Microtiter plates were incubated for 24h at room temper-ature in 0.1M PBS pH 8.3 containing 2% (w/v) BSA. Afterwashing with 0.1M PBS pH 8.3, 100  l of heterobifunc-tional cross-linker solution (32  M SMPB) was added perwell and incubated for 4h at room temperature. The differ-ent peptides were used at different concentrations diluted in0.1M PBS pH 8.3 and incubated on the BSA–SMPB pre-coated plates overnight at room temperature. Non-specificsites were thereafter blocked using 0.1M PBS pH 7.4 con-taining 5% (w/v) BSA as described before [23]. 2.6. Cell attachment assays HBMSC (10 5 cells/cm 2 ) were plated into 96-plate wellscoated or not with RGD peptides and incubated for 1hat 37 ◦ C. The non-adherent cells were removed by wash-ing with 0.1M PBS pH 7.4. Adherent cells were quanti-fied by measurement of the activity of the lysosomial en-zyme,  N  -acetyl-  - d -hexosaminidase, using a substrate solu-tion (7.5mM of   p -nitrophenyl  N  -acetyl-  - d -glucosaminide,0.1M Na citrate pH 5, 0.5% (v/v) Triton-X 100) as de-scribed by Landegren [14] with some modifications. Resultsare expressed in percentage of cell attachment onto RGD-containingpeptidesnormalizedforadhesiontoplasticdisheswhich is defined as 100%. 2.7. Cell extracts HBMSC were cultured onto different coatings (10  g/mlof fibronectin, poly- l -lysine 0.005% (w/v), cyclo DFKRGpeptides or cyclo RAFK at 100  M) for 15, 30, 60min,in serum-free IMDM. Cells were extracted at 4 ◦ C in ice-cold lysis buffer RIPA (Radio Immuno Precipitation As-say) 10mM Tris–HCl pH 7.5, 2mM EDTA, 150mM NaCl,50mMNaF,1%(v/v)NonidetP-40,2mMNa 3 VO 4 ,2  g/mlleupeptine, 25  g/ml aprotinine, 5mM   -mercaptoethanol,1mM phenylmethylsulfonyl fluoride, 2mM sodium ortho-vanadate). Then, cell extracts were clarified by centrifuga-tion at 10,000 × g  at 4 ◦ C for 15min. Protein content is de-termined using the Lowry et al. [17] method.  S. Pallu et al./Peptides 24 (2003) 1349–1357   1351 2.8. p 125 FAK, MAP kinases (Erk 1/2) and p38  phosphorylation analysis Thirty micrograms of total proteins extracted fromHMBSC were subjected to SDS–PAGE according toLaemmli [13]. Thereafter the proteins were transferred to nitrocellulose membranes (Hybond, Bio-Rad), and an-alyzed by Western blotting using monoclonal antibodyagainst p 125 FAK (EUROMEDEX) diluted at 1/2000, or us-ing a polyclonal antibody against MAP kinase 1/Erk 1/p44and MAP kinase 2/Erk 2/p42 (EUROMEDEX) diluted at1/2000, using a monoclonal antibody against PY20 (EU-ROMEDEX) diluted at 1/500, using a monoclonal antibodyagainst p38 (SIGMA) diluted at 1/1000 or a polyclonalantibody against phospho-p38 (SIGMA) diluted at 1/1000in 0.1M TBS containing 0.1% (v/v) Tween-20 and 5%(w/v) milk. Immunoglobulins were revealed by horseradishperoxidase-conjugated secondary antibodies diluted at1/1000. The reaction was developed by enhanced chemi-luminescence (Pierce, “Supersignal West Pico Chemilu-minescent Substrate”; Amersham Life Science HyperfilmECL). Immunoblot of    -tubulin with a monoclonal anti- Fig. 2. Western blot analysis of p 125 FAK in HBMSC cultured for 15–60min on plastic culture dishes (P), on cyclo DFKRG peptide (RGDc: 100  M),on fibronectin (FN: 10  g/ml), and poly- l -lysine (PLL: 0.005%, w/v). (A) Western blots of p 125 FAK and phosphorylated (PY20) p 125 FAK. (B)Chemiluminescence products were quantified using NIH 1.62 image analyzer. Results are expressed in PY20/p 125 FAK and are related to   -tubulinsynthesis. Results represent means ± standard deviation (S.D.) ( n = 3).Fig. 1. Study of HBMSC adhesion onto plastic dishes coated with cy-clo DFKRG, cyclo RAFK (100  M) as negative control, fibronectin(10  g/ml) and poly- l -lysine (PLL at 0.005%, w/v). Adherent cellswere quantified by measurement of the activity of the lysosomial en-zyme:  N  -acetyl-  - d- hexosaminidase. Results are expressed in percent-age of cell adhesion normalized for adhesion to plastic dishes whichis defined as 100%. Results represent means  ±  standard deviation( n = 4). body diluted at 1/1000 (EUROMEDEX) is used as control.Densitometric scans were performed using NIH 1.62 im-age analyzer. For each experiment, the data for the varioustime points were taken from the same filter and the sameexposure (5min).  1352  S. Pallu et al./Peptides 24 (2003) 1349–1357  2.9. Measurement of protein tyrosine kinase activities Protein tyrosine kinase (PTK) activities contained in10–25  g of the cell extracts are determined by using“Sigma TECT Protein Tyrosine Kinase Assay System”. 2.10. Mineralization analysis by radiolabeling of thecultures with  45 Ca Incorporation of   45 Ca into the cultures [24] wereperformed using HBMSC cultured for three days inserum-free medium supplemented or not with 10  M   -glycerophosphate and 10mM ascorbic acid. Cells wereseeded onto the plastic culture dishes coated or not withthe cyclo peptides. After 3 days of culture, cell layer andmatrix were scraped and  45 Ca incorporated was quantifiedusing a   -counter (Packard) after treatment wit 10% (v/v)formic acid. 3. Results 3.1. Cyclo DFKRG peptides stimulate HBMSC adhesion As previously demonstrated, HBMSC expressed a broadrange of adhesion proteins including   3,   5,   v,   1 and Fig. 3. Measurement of protein tyrosine kinase (PTK) activities of HBMSC seeded for 15–60min onto plastic culture dishes (P) or onto different coatings:cyclo DFKRG (100  M), fibronectin (FN) 10  g/ml, and poly- l -lysine (PLL at 5%, w/v). Measurement of PTK activities are performed using cellextracts from HBMSC cultured as described in Section 2. Results are expressed in fmole of phosphate transferred/min/   g of protein. Results representmeans ± standard deviation (S.D.) ( n = 4).  3 subunits [23]. These cell-surface receptors recognize specific domains on ECM proteins and our previous study[23] revealed that HBMSC adhere at various level accord-ing to the coated proteins (fibronectin, vitronectin, type Icollagen, etc.) or to the sequence and conformation of RGD-containing peptides coated to the plastic culture dishes.As shown in Fig. 1, HBMSC bound strongly to the cyclo DFKRG peptides coated at 100  M, while fibronectin at10  g/ml increases at a lower extent cell adhesion. Cells ini-tially adhered to poly- l -lysine (PLL) in higher number as tofibronectin (FN) or cyclo DFKRG, but the binding to PLL ismainly through ionic charges. Results are expressed in per-centage of cell adhesion normalized for adhesion to plasticdishes treated for cell culture which is defined as 100%. 3.2. Cyclo DFKRG peptides activate cell adhesion, throughof signaling reactions induced phosphorylation of p 125 FAK, protein tyrosine kinases and MAP kinases activities Surfaces coated with cyclo RGD peptide produced adifferent time course of tyrosine phosphorylation in thep 125 FAK area (Fig. 2A) as demonstrated by Western blot analysis performed in first time using an antibody againstp 125 FAK and then using an anti-phosphotyrosine (PY20).  -Tubulin was used as control (data not shown). Using cy-clo DFKRG, tyrosine phosphorylation of the focal adhesion  S. Pallu et al./Peptides 24 (2003) 1349–1357   1353 kinase reached a maximum after 15min of cell seeding(Fig. 2B) as for cells cultured onto plastic culture dishes and then decreased. Fibronectin coatings induce a similarkinetic of phosphorylation according to the engagement of integrins upon adhesion but with a lower extent. Integrin in-dependent cell adhesion conferred by poly- l -lysine inducesthe lowest level of phosphorylation of this protein.Then, we have investigated the well known kinase activi-ties involved in this process, including PTKs and serine thre-onine kinases (i.e. MAPK). PTKs play a critical role in themodulation of a wide variety of cellular events, includingdifferentiation growth and metabolism. PTKs activities of HBMSC cultured for 15–60min at 37 ◦ C on plastic culturedishes, on cyclo DFKRG, poly- l -lysine and fibronectin werequantified and results presented in Fig. 3, revealed a maxi-mum of PTK activities after 30min of culture on the cycloRGD-peptide. Unspecific adhesion as conferred by poly- l -lysine induces a basal protein tyrosine kinase activities, inopposite to the specific adhesion conferred by fibronectincoating, but to a lesser extent than RGD-surfaces. PTKs ac-tivities of HBMSC cultured on plastic culture dishes weresimilar to those observed on fibronectin. Fig. 4. Western blot analysis of MAP kinase (Erk 1/2) activities in HBMSC cells cultured for 15–60min on plastic culture dishes (P), on cyclo DFKRGpeptide (RGDc: 100  M), on fibronectin (FN: 10  g/ml), and poly- l -lysine (PLL: 0.005%, w/v). (A) Western blots of Erk 1/2 (anti-Erk 1/2) andphosphorylated Erk 1/2 (PY20). (B) Chemiluminescence products were quantified using NIH 1.62 image analyzer. Results are expressed in PY20/Erk 1;PY20/Erk 2 and are related to   -tubulin synthesis. Molecular weight of proteins are in kDa. Results represent means ± standard deviation (S.D.) ( n = 4). The level of expression of MAPK proteins (Erk 1and Erk 2 isoforms) and activated MAPK were deter-mined at 15, 30 and 60min by Western blot (Fig. 4A)in a first time using an anti-Erk 1/2 and then using ananti-phosphotyrosine (PY20). Quantitative analysis of im-munolabeling revealed that activation of Erk 1 and Erk 2were stimulated on cyclo DFKRG and decreased both onplastic culture dishes, FN and PLL (Fig. 4B). Cells plated on cyclo DFKRG peptides showed an increase in Erk 1phosphorylation as early as 15min followed by a gradualdecrease. Thus, Erk 2 activation was slightly delayed onthe same substrate and occurred at 30min. Activation of Erk 2 of HBMSC cultured on plastic culture dishes weresimilar to those observed on fibronectin coating while Erk 1 seems to be stimulated after 60min of cell seeding ontoplastic.Finally, p38 MAPK phosphorylation was in addition stim-ulated on cyclo DFKRG peptide at 30min and then main-tained at 60min. Activation of p38 on FN follows the samekinetic of phosphorylation, while on PLL and on plastic cul-ture dishes, phosphorylation occurred after 60min of culture(Fig. 5).
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks