Reports

A fluorescent assay suitable for inhibitor screening and vanin tissue quantification

Description
A fluorescent assay suitable for inhibitor screening and vanin tissue quantification
Categories
Published
of 9
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  A fluorescent assay suitable for inhibitor screening and vanin tissue quantification Benfang H. Ruan a, * , Derek C. Cole b , Paul Wu a , Amira Quazi a , Karen Page a , Jill F. Wright a , Nelson Huang b , Joseph R. Stock b , Karl Nocka a , Ann Aulabaugh c , Rustem Krykbaev a , Lori J. Fitz a , Neil M. Wolfman a ,Margaret L. Fleming a a Inflammation and Immunology, Pfizer Biotherapeutics R&D, Cambridge, MA 02140, USA b Chemical Sciences, Pfizer, Pearl River, NY 10965, USA c Screening Sciences, Pfizer, Pearl River, NY 10965, USA a r t i c l e i n f o  Article history: Received 28 October 2009Received in revised form 3 December 2009Accepted 8 December 2009Available online 14 December 2009 Keywords: Vanin-1Fluorescent assayInflammatory diseaseHTS assayLead identificationTissue quantification K  m Pantetheinase activity a b s t r a c t Vanin-1isapantetheinasethatcatalyzesthehydrolysisofpantetheinetoproducepantothenicacid(vita-min B5) and cysteamine. Reported here is a highly sensitive fluorescent assay using a novel fluorescentlylabeledpantothenatederivative.Theassayhasbeenusedforcharacterizationofasolubleversionofhumanvanin-1 recombinant protein, identification and characterization of hits from high-throughput screening(HTS),andquantificationofvaninpantothenaseactivityincelllinesandtissues.Underoptimizedassaycon-ditions,wequantifiedvaninpantothenaseactivityintissuelysateandfoundlowactivityinlungandliverbuthighactivityinkidney.Wedemonstratedthatthepurifiedrecombinantvanin-1consistingoftheextra-cellular portionwithout the glycosylphosphatidylinositol (GPI) linker was highlyactivewithanapparent K  m  of 28 l M for pantothenate–7-amino-4-methylcoumarin (pantothenate–AMC), which was convertedto pantothenic acid and AMCbased on liquid chromatography–mass spectrometry (LC–MS) analysis. Theassay also performed well in a 384-well microplate format under initial rate conditions (10% conversion)with a signal-to-background ratio (S/B) of 7 and a  Z   factor of 0.75. Preliminary screening of a library of 1280 pharmaceutically active compounds identified inhibitors with novel chemical scaffolds. This assaywill beapowerful toolfortargetvalidationanddrugleadidentificationandcharacterization.   2009 Elsevier Inc. All rights reserved. Pantetheinase activity has been correlated to oxidative stressand inflammation [1–7], suggesting a possible role for vanin-1 asa tissue sensor in pathological conditions associated with a largeoxidative stress component. Vanin-1 is a member of the biotini-dase family and is expressed at the cell surface via a glycosylphos-phatidylinositol (GPI) 1 anchor in epithelial cells [3]. Vanin-1knockout mice are resistant to systemic oxidative stress and intesti-nal inflammation, as evidenced by the decreased presence of inflam-matory mediators and increased antioxidative responses [1,8].Vanin-1 knockout mice lack detectable cysteamine in tissues,suggesting that catabolism of pantetheine by vanin-1 is the primarysource of endogenous cysteamine. Interestingly, cystamine (oxidizedform of cysteamine) administration to vanin-1 knockout animals re-verses the protection observed in intestinal and oxidative stressmodels [6]. Vanin-1, via its pantetheinase activity, regulates the spe-cific intracellular pathways that lead to generation of pro-inflamma-tory mediators. Therefore, inhibiting vanin-1 pantetheinase activitymight be beneficial in treating inflammatory bowel disease. Pantetheinase assays reported so far are not suitable for high-throughputscreening(HTS)becausetheassayseitherrequireradio-activematerialsorresultinaproductthatisinsensitivetodetection.For example, early assay formats measured cysteamine productionbyderivatizingcysteaminefollowedbychromatographicseparation[9–13] or measured pantothenic acid (vitamin B5) formation using 14 C-labeledpantetheinefollowedbypaperchromatography[14].La-ter,anassayusing S  -pantetheine-3-pyruvateassubstratewasdevel-oped. Hydrolysis gives pantothenic acid and  S  -cysteamine-3-pyruvate, whichthenspontaneouslycyclizes toaminoethylcysteineketamine that can be quantitated by ultraviolet (UV) absorbance at296nm [15]. However,  S  -pantetheine-3-pyruvate is unstable, andUV absorbance measurement at 296nm is not suitable for HTSbecause many small molecules absorb at this wavelength and will 0003-2697/$ - see front matter    2009 Elsevier Inc. All rights reserved.doi:10.1016/j.ab.2009.12.010 *  Corresponding author. Fax: +1 617 665 5386. E-mail addresses:  ruanb@wyeth.com, ruanbf@yahoo.com (B.H. Ruan). 1  Abbreviations used:  GPI, glycosylphosphatidylinositol; HTS, high-throughputscreening; UV, ultraviolet; pantothenate–AMC, pantothenate–7-amino-4-methyl-coumarin; LOPAC, library of pharmacologically active compounds; TFA, trifluoroaceticacid; DMSO, dimethyl sulfoxide; HPLC, high-performance liquid chromatography;MS, mass spectrometry; ESI, electrospray ionization; NMR, nuclear magneticresonance; cDNA, complementary DNA; PCR, polymerase chain reaction; CMV,cytomegalovirus; DHFR, dihydrofolate reductase; CHO, Chinese hamster ovary; PBS,phosphate-buffered saline; SDS–PAGE, sodium dodecyl sulfate–polyacrylamide gelelectrophoresis; SEC–MALS, size exclusion chromatography–multiangular lightscattering; DTT, dithiothreitol; BSA, bovine serum albumin; EX, excitation; EM,emission;  t  R  , retention time; S/B, signal-to-background ratio; SD, standard deviation;IQR, interquartile range; BCA, bisinchoninic acid; qRT, quantitative reverse transcrip-tion; BME,  b -mercaptoethanol; mRNA, messenger RNA. Analytical Biochemistry 399 (2010) 284–292 Contents lists available at ScienceDirect Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio  interfere.Recently,anitroanilidederivativeofpantothenatewasusedasavanin-1substratewithUV/visiblereadoutat400nm,althoughnochemical structure was disclosed [7]. Again, UV/visible absorbancemeasurementat400nmmightnotbesuitableforHTSbecausesmallmoleculesmayinterfere.Therefore,weinvestigatedotherpantothe-nate derivatives as potential vanin-1substrates todevelopanassaythatissuitableforHTSandforthequantitationofvanin-1invariouscelltypesandtissues.Reportedhereisthedevelopmentofavanin-1HTS-amenableassayusingpantothenate–7-amino-4-methylcouma-rin(pantothenate–AMC)as asubstrateandapplicationofthisnovelfluorescentassaytoscreenaLOPAC(libraryofpharmacologicallyac-tivecompounds)toidentifysmallmoleculevanin-1inhibitorsandtoquantifyvanin-1inmousetissueextracts. Materials and methods Materials b -Alanine7-amido-4-methylcoumarinwaspurchasedfromChem-Impex International (Wood Dale, IL, USA), and other chemicals werepurchasedfromSigma–Aldrich(St.Louis,MO,USA).Proteinpurifica-tion reagents were obtained from Pierce (Rockford, IL, USA). AssayswereruninMatrix384-well polypropyleneplatesusingaPlateMate2   2robotbyMatrix(Hudson,NH,USA).Fluorescentassayswerecar-riedoutonanEnvisionplatereader(PerkinElmer,Waltham,MA,USA)oraSafiremultidetectionmonochromator microplatereader (Tecan,Durham,NC,USA).NIC-H292cellswereobtainedfromAmericanTypeCultureCollection(ATCC,Manassas,VA,USA). Chemical synthesis of pantothenate–AMC  A solution of   b -alanine 7-amido-4-methylcoumarin trifluoro-acetic acid (TFA) salt (H- b -Ala-AMC.TFA, 36mg, 1eq) and  R -(  )-pantolactone (45mg, 3eq) was heated to 60  C in ethanol (5ml)for 2days. The solvent was evaporated, and the residue was dis-solved in dimethyl sulfoxide (DMSO)/water and purified by re-verse-phase high-performance liquid chromatography (HPLC) ona C18 column with 5% to 95% acetonitrile in water containing0.05% TFA buffer to give pantothenate–AMC (32mg, >99% purity)as a white powder. MS (ESI)  m /  z   377.1 (M+H) + ,  1 H NMR (300MHz, DMSO- d 6 )  d  10.41 (br s, 1H), 8.04 to 7.62 (m, 3H), 7.47(dd,  J   =9.0, 3.0Hz, 1H), 6.27 (s, 1H), 5.39 (d,  J   =5.7Hz, 1H), 4.47(5,  J   =5.7Hz, 1H), 3.71 (d,  J   =5.7Hz, 1H), 3.48 to 3.14 (m, 4H),2.58 (t,  J   =6.9Hz, 2H), 2.39 (s, 3H), 0.80 (s, 3H), 0.77 (s, 3H). Vanin-1 plasmid constructs Human vanin-1 complementary DNAs (cDNAs) were purchasedfrom Origin and subcloned into pDEST12.2 vector by homologousrecombination using Gatewaytechnology. Human vanin-1 ectodo-main construct (amino acid position 22–483) was modified byreplacing the endogenous vanin-1 leader with the honeybee mela-nin prepro leader followed by a Gly-Ser-Gly-His6   tag–Gly-Ser-Gly-Flag tag by overlap polymerase chain reaction (PCR) of 45 to50bp synthetic oligonucleotides and cloned by InFusion cloning(Clontech,MountainView,CA,USA)intopDONR221,whichwasper-formedbyDragonflySciences(Wellesley,MA, USA). TheinsertwasGateway subcloned into a mammalian expression vector with acytomegalovirus (CMV) promoter. All PCR-derived products weresequencedtoensuresequencefidelity. Expression and purification of human vanin-1 protein Dihydrofolate reductase (DHFR)-negative Chinese hamsterovary(CHO)DUKXcellsweretransfectedwiththeabove-describedvanin-1 ectodomain plasmid construct using the transfection re-agent TransIT LT1 (Mirus Bio, Madison, WI, USA) and subsequentlyputinto20nMmethotrexateforselectionfor2weeks.Cloneswerepicked and analyzed for expression level by anti-His6   Westernblot analysis. The best clonewas expandedintoHYPERFlask(Corn-ing, Lowell, MA, USA). Once the cells were confluent, the mediumwas changed to serum-free medium R1CD1 and the temperaturewas shifted to 32  C. Three harvests of conditioned medium werecollected after 3days each.TherecombinantHis-andFlag-taggedvanin-1waspurifiedovera10-mlHisTrapFastFlowcolumn(GEHealthcare,Piscataway,NJ,USA).Bound protein was washed with 50mMTris, 1M NaCl, and 15mMimidazolebuffer(pH8.0).Therecombinantvanin-1waselutedwith50mM Tris, 1M NaCl, and 250mM imidazole buffer (pH 8.0), dia-lyzedagainstphosphate-bufferedsaline(PBS,pH7.2),andcharacter-ized by sodium dodecyl sulfate–polyacrylamide gel electrophoresis(SDS–PAGE) gels and Western blot analysis using 10% tricine gels(Invitrogen, Carlsbad, CA, USA). The molecular weight was deter-minedbysizeexclusionchromatography–multiangularlightscatter-ing(SEC–MALS)analysisasfollowings.Therecombinantvanin-1wasinjected onto a YMC-Pack Diol-300 column (500   8.0mm i.d.,Waters) using a Waters HPLC unit. The columnwas developed with50mM phosphate buffer with 300mM NaCl (pH 7.2) at a flow rateof1ml/min. TheelutedproteinsweredetectedbyaminiDAWNTri-star multiangular light scattering device connected in tandem withan OptiLab rEX refractive index detector (Wyatt Technology, SantaBarbara, CA, USA) to determine the homogeneity and molecularweightoftheproteinasitmigratesthroughtheSECcolumn.Thepuri-fied recombinant vanin-1 was greater than 95% pure by Coomassieblue stain analysis, and the endotoxin level was less than 1EU/ml.Theprotein(1.75mg/ml)wasstoredinPBSat  80  C. LC–MS analysis of pantothenate–AMC hydrolysis by vanin-1 Pantothenate–AMC (200 l M, 100 l l) was incubated in phos-phate buffer (100mM potassium phosphate buffer [pH 8.0],5mM dithiothreitol [DTT], 0.01% bovine serum albumin [BSA],and 0.0025% Brij-35) in the presence or absence of vanin-1 protein(100nM) at 37  C for 1h. The reaction products were detected byfluorescent analysis using an excitation (EX) wavelength of 350nm and an emission (EM) wavelength of 460nm by a Safireplate reader. The products were characterized by LC–MS analysisperformed on a Waters LCT mass spectrometer coupled with anAgilent 1100 HPLC device. The HPLC column (Waters Symmetry2.1   50mm, 3.5 l m) was developed in a gradient of solvent A(water with 0.1% formic acid) and solvent B (acetonitrile with0.1% formic acid) at a flow rate of 0.6ml/min. The gradient startedat2%solventBinsolventAfor3min,linearlyrampedto5%solventB in 4min and then to 100% solvent B in 4min, and finally held at100% solvent B for another 2min. The eluted fractions were ana-lyzed by MS with ESI using the following parameters: capillaryvoltage, 3500V; cone voltage, 25V; desolvation temperature,350  C; source temperature, 120  C; scan speed, 100 to 2000Dain 1s. Data acquisition was made by alternating between positiveion mode and negative ion mode with an interscan delay of 0.7s.  Assay optimization Theoptimalassayconditionswereobtainedbyvaryingtheindi-vidual buffercomponents—DTT(0 l M–50mM),DMSO(0–50%), pH(3–10),andvanin-1(10pM–32nM)in50mMpotassiumphosphatebuffer containing 0.01% BSA, 0.0025% Brij-35, and pantothenate–AMC (1 or 2 l M) in a black 384-well at 25  C for 1h. The progressof the reaction was followed every 2min by fluorescence (Safire,EX350±2.5nm,EM460±2.5nm),andtheconversionratewascal-culated using standard titration curves of AMC and pantothenate–  Assay for vanin tissue quantification/B.H. Ruan et al./Anal. Biochem. 399 (2010) 284–292  285  AMC. The final assay conditions used in subsequent experimentswere phosphatebuffer B: 100mMpotassiumphosphatebuffer (pH7.5),0.01%BSA,0.5mMDTT,1%to5%DMSO,and0.0025%Brij-35. K  m  value for pantothenate–AMC  The  K  m  measurement was done in 30 l l of reaction mixturescontaining vanin-1 (0.5nM) and pantothenate–AMC (0–120 l M)in phosphate buffer B. Reactions were carried out in triplicate at25  C in the presence or absence of vanin-1 enzyme, and the fluo-rescence (Safire, EX 350±2.5nm, EM 460±2.5nm) was recordedevery 2min. The amount of AMC produced in each reaction wasdetermined by two methods. One is to convert fluorescence intomass based on AMC fluorescent dose–response curve (EM460nm). The other method is to separate pantothenate–AMC(retention time [ t  R  ]=6.0min) and AMC ( t  R   =7.1min) by reverse-phase HPLC (Phenomenex Luna C18 column, 4.6   250mm,5 l m) in a linear gradient of solvent A (water with 0.1% TFA) andsolvent B (acetonitrile with 0.1% TFA) and then to quantify AMCbased on UV absorbance, which showed linear dose response forboth AMC (355nm) and pantothenate–AMC (331nm). The appar-ent  K  m  values were determined in KaleidaGraph 3.0 by fitting theinitial velocities of AMC production at various pantothenate–AMCconcentrationstothehyperbolicMichaelis–Mentenequation.  Assay performance To evaluate the quality of the assay for use in an HTS campaign,performancewasassessedbycalculatingthe  Z  factorvalueoftheva-nin-1 HTS assay. Reactions (4224) were carried out in 11 384-wellplates. Among these, 50% of the reactions included 0.5nM vanin-1(highcontrol)andtheother50%hadthesamevolumeofbufferwith-out vanin-1 (low control). The signal of the high controls was ob-tained by incubating 1 l M pantothenate–AMC with vanin-1(0.5nM) in the optimized phosphate buffer B at 25  C for 1h. Thelow controls were obtained in the absence of vanin-1, and the sig-nal-to-background ratio (S/B) of the assay at initial rate conditionswascalculatedbydividingthemeanof thepositivecontrolsbythemeanofthenegativecontrols.Atotalof4224datapointswerecol-lectedfromthe11384-wellplates.The  Z  factorvaluewascalculatedusingthefollowingequation:  Z   ¼  1  ½ð 3SD of high control Þþ ð 3SD of low control Þ = jð mean of high control  mean of low control Þj :  ð 1 Þ Hit identification using LOPAC  A small set of pharmaceutically active compounds was thenevaluated in the assay to identify hits and to determine the levelof compoundopticalinterference. Compounds(1280)fromtheLO-PAC set (Sigma–Aldrich) were diluted in DMSO. In 384-well plates,compounds (10 l M) in DMSO, pantothenate–AMC (1 l M final),and vanin-1 (0.6nM final) in phosphate buffer B were added insequential order, and the reactions were carried out in triplicateat 25  C for 1h. The no-compound control was used as the highcontrol (0% inhibition), and the substrate conversions were 10%based on calibration curves generated using AMC. The no-enzymecontrol was used as the lowcontrol (100% inhibition), and the per-centage inhibition was calculated using the following equation: % inhibition  ¼  100  ½ 1  ð S    low control Þ = ð high control  low control Þ ;  ð 2 Þ where S  isthefluorescentsignalinthepresenceofinhibitor.Themed-ian and the corresponding interquartile range (IQR) values wereobtainedfromSpotfireanalysis,andhitsweredefinedasgreaterthanthecutoff%inhibition=median%inhibition+3   IQR/1.34.Acounterscreen assay, using AMC instead of vanin-1 enzyme, was run underthesameconditiononthehitstoidentifycompoundsthatinterferedwiththeassaydetection. IC  50  measurement  Threefold dilutions of compounds were made in 100% DMSO.Compounds (50 l M–0.85nM), pantothenate–AMC (1 l M), and va-nin-1 (0.6nM) in final concentrations were mixed in optimizedphosphate buffer B containing 3% DMSO in 384-well plates, andthe reaction was carried out in duplicate at 25  C for 1h. In addi-tion, a counter screen assay was carried out under the same condi-tions except that the addition of vanin-1 (0.6nM) was replacedwith AMC (60nM). IC 50  values from both assays were calculatedfrom the fit of the % inhibition of individual dose–response curvesusing Eq. (3): % inhibition  ¼  100  ½ C  n = ð IC  50  þ  C  n Þ ;  ð 3 Þ where  C   is the inhibitor concentration and  n  is the Hill slope deter-mined by curve fitting. Quantification of vanin-1 in cells and tissue homogenates NCI-H292 lung epithelial cells, previously transfected and se-lectedfor stable expressionof humanvanin-1or control, werepla-tedin96-wellplatesandallowedtogrowtoconfluence.Cellswerewashed three times with PBS and lysed with RIPA buffer (100 l l).Cell lysate (50 l l), pantothenate–AMC (20 l M final), and DTT(0.1mM final) were mixed in PBS in a 96-well plate, and thechange in fluorescence was measured over a 90-min period. Astandard curve was generated using purified recombinant vanin-1 under the same buffer conditions to adjust for RIPA buffer effect.Remaining lysate was used to measure total protein using abicinchoninic acid (BCA) protein assay (Thermo Scientific, Rock-ford, IL, USA). Vanin-1 activity was calculated by taking the slopeat 60min, fitting the data to the standard curve, and normalizingfor total protein content.Mouse tissues were harvested from C57Bl/6 mice and homoge-nized in potassium phosphate buffer with 0.1% Triton X-100 and0.6% sulfosalicylic acid. Protein amounts were determined by BCAproteinassay,and10 l gofproteinwasassayedforvanin-1activityusing the conditions described above. Quantitative reverse transcription–PCR Mouse tissues were harvested from C57Bl/6 mice and homoge-nized in RLT buffer. Homogenate was cleared over a QIAshreddercolumn, RNA was prepared using RNeasy mini columns, and geno-micDNAwasremovedbytreatmentwithDNase(Qiagen,Valencia,CA,USA).TheconcentrationoftotalRNAineachsamplewasdeter-mined by absorbance at 260nm.Oligonucleotides were designed to mouse  b -actin and mousevanin-1usingPrimer Expresssoftware(AppliedBiosystems, FosterCity, CA, USA). Forward and reverse primer sequences were as fol-lows:  b -actin 5 0 ACGGCCAGGTCATCACTATTG and 5 0 CAAGAAGGAAGGCTGGAAAAGA, mouse vanin-1 5 0 TTAAAAGCCAGTTCGCTGGATAC and 5 0 GGGTGTCCTTAGGCAGGATCA. Probes with a 5 0 FAM re-porter dye and a 3 0 TAMRA quencher were also generated as fol-lows:  b -actin 5 0 CAACGAGCGGTTCCGATGCCC, mouse vanin-1 5 0 TTCCTCGCGGCTGTTTACGAGCA. Duplicate reactions were set upin a 384-well plate using a quantitative reverse transcription(qRT)-PCR MasterMix (Quanta Biosciences, Gaithersburg, MD,USA) and 25ng of template RNA per reaction and were analyzedusing a 7900 Real Time PCR System (Applied Biosystems). Data 286  Assay for vanin tissue quantification/B.H. Ruan et al./Anal. Biochem. 399 (2010) 284–292  were fitted to a standard curve generated from a positive controlsource of RNA, and expression values for vanin-1 were normalizedto those for  b -actin within each sample. Results and discussion Characterization of the vanin-1 enzyme Toexaminevanin-1pantetheinaseactivity,asolubleformofva-nin-1 was cloned with the C-terminal GPI signal and downstreamsequences removed, the addition of an N-terminal His6 tag andFlag tag, and replacement of the endogenous signal peptide withthe honeybee prepromelittin (Fig. 1A). His-and Flag-tagged va-nin-1, produced in CHO cells, was purified using nickel affinitychromatography and showed greater than 95% purity by SDS–PAGE gel (Fig. 1B). The molecular weight of the purified recombi-nant vanin-1 determined by SEC–MALS was 72,690g/mol(Fig. 1C), whereas the theoretical molecular weight for vanin-1 is54kDa. This suggested that the recombinant vanin-1 is glycosyl-atedatseveralofitssixpotentialN-linkedglycosylationsitesasre-ported previously [17]. The activity of the purified recombinantvanin-1 was measured by hydrolysis of its natural substrate, pan-tetheine. The complete conversion of pantetheine ( t  R   =4.56min, m /  z   279, 301, 317) to cysteamine and pantothenic acid( t  R   =0.89min,  m /  z   220, 242, 258) after vanin-1 hydrolysis was ob-served by LC–MS analysis. Feasibility of pantothenate–AMC as a substrate for vanin-1 Thetraditionalmethodsforvanin-1quantificationusepantethe-ine (the natural vanin-1 substrate) or pantetheine-3-pyruvate (asynthetic derivative), but neither is a suitable substrate for HTS. AsimpleandsensitiveHTSassaymayconsistofanonfluorescentsub-stratethat,afterhydrolysis,releasesafluorescentmoleculethatmayeasilybequantifiedbyfluorescentintensity.Afluorescentlylabeledpantetheine derivative is a possible substrate for such an assay.However,itwasnotclearwhethertheadditionalfluorescentgroupwouldpreventthesubstratefrombindingandbeinghydrolyzedbyvanin-1 because not all pantetheine derivatives are vanin-1 sub-strates.Dupreandcoworkers[15]discoveredthatvanin-1hasgoodsubstrate specificity for certain pantetheine derivatives such as S  -patetheine-3-pyruvate. However, other derivatives such aspantetheine-4 0 -phosphate have only approximately 10% activitycompared with pantetheine. Still other derivatives, such as panto-thenoyl-cysteine-4 0 -phosphate, pantothenoylcysteine, pantetheinethiazoline,andcoenzymeA,couldnotbehydrolyzedbyvanin-1.In any case, the initial effort was to test pantothenate–AMC inwhich the cystamine moiety of pantetheine is replaced with theAMC moiety (Fig. 2A), with the hope that pantothenate–AMC (anamide) would be hydrolyzed to give  D -pantothenic acid and AMC(anamine).AsshowninFig.2B,afterexcitationat340nm,thesub-strate (pantothenate–AMC) and the expected product (AMC) showdifferentemissionspectraat460nM. Theweakfluorescencesignalfrom the pantothenate–AMC increases approximately 20-foldwhen the amide bond is cleaved to release the free amine (AMC),providing a significant window for a sensitive assay.Next we asked whether vanin-1 can cleave pantothenate–AMC.Incubation of pantothenate–AMC withthe recombinant vanin-1 orthe native vanin-1-containing lysate led to an increase in fluores-cent signal(EX340nm, EM460nm) withincubationtime, indicat-ing rapid hydrolysis (Fig. 2C).Thechemicalnatureofthehydrolysisproductswasfurthercon-firmed by LC–MS analysis. In the absence of recombinant vanin-1,pantothenate–AMC ( t  R   =9.9min,  m /  z   377, M+H + [Fig. 2E]) re-mained stable after 1h (Fig. 2D, top panel) because a single peakwas detected with a  t  R   of 9.9min, which was identified as panto-thenate–AMC by MS [ m /  z   377 (M+H + , calc. 377);  m /  z   399(M+Na + , calc. 399);  m /  z   359 (M  H 2 O+H + , calc. 359)], as shown inFig. 2E, indicating no hydrolysis. After 1h in the presence of va-nin-1, the pantothenate–AMC ( t  R   =9.9min) peak disappeared,and two new peaks with  t  R   at 1.6 and 9.8min were observed(Fig. 2D, bottom panel). The peak at 1.6min was identified as  D -pantothenic acid based on its mass spectrum[ m /  z   258 (M+K + , calc.258);  m /  z   242 (M+Na + , calc. 242);  m /  z   220 (M+H + , calc. 220)], asshown in Fig. 2F, and the peak at 9.8min was AMC [ m /  z   198(M+Na + , calc. 198);  m /  z   176 (M+H + , calc. 176)], as shown inFig. 2G. This demonstrated that pantothenate–AMC was hydro-lyzed by vanin-1 at the amide bond.  Assay optimization and robustness of the assay Vanin-1belongstothenitrilasesuperfamily,whichcontainstheinvariant catalytic triad residues: glutamate, lysine, and cysteine[18]. Regenerationof theactivesitecysteine(Cys211inhumanva-nin-1) is critical for the enzymatic activity [19]. Therefore, weinvestigated whether the concentration of reducing agent DTT isimportant for vanin-1 enzymatic activity. Interestingly, vanin-1activity was reduced in the absence of DTT, in the presence of ahigh level of 50mM DTT, or with the use of   b -mercaptoethanol(BME). This indicated that the in vitro assayrequires DTT to regen-erate vanin-1 activity, but too much DTT also inhibits the enzymeactivity (Fig. 3A). DTT concentrations between 0 and 50mM weretested, and the optimal concentration was 0.4mM (Fig. 3A). The Fig. 1.  Vanin-1 cloning and purification. (A) Human vanin-1 ectodomain construct. The honeybee prepromelittin leader peptide is boxed with a solid line. The His6 tag isboxed with a dashed line. The Flag tag is indicated byoverhead carets, and the six putative N-linkedglycosylation sites are underlined. (B) Coomassie blue-stained gel imageof the purified recombinant vanin-1. Lane 1: molecular weight markers; lanes 3, 4, and 5: 5, 10, and 15 l g of nonreduced protein, respectively; lanes 7, 8, and 9: 5, 10, and15 l g of reduced protein. (C) Multiangular light scattering chromatogram of purified recombinant vanin-1.  Assay for vanin tissue quantification/B.H. Ruan et al./Anal. Biochem. 399 (2010) 284–292  287  optimalpHfortheenzymeisbetween6.5and8.0(Fig. 3B). Greatlyreduced vanin-1 activity was observed at both acidic (pH 3.0) andbasic (pH 10.0) conditions, in agreement with the early report thatvanin-1playsaroleinintestineandboweldiseasewhereepithelialcells are under essentially neutral pH conditions [1].ForHTSandhitcharacterization, DMSOiscriticalforcompoundsolubility; therefore, it is important to determine the maximalamountofDMSOthatmaybetoleratedinthevanin-1assay.Essen-tially the same activity was observed between 0% and 4% DMSO,but a steep drop of vanin-1 activity was observed at higher DMSOconcentrations(Fig.3C).Undertheoptimalbufferconditionsinthepresence of 1 l M pantothenate–AMC, the recombinant vanin-1(0.06–0.5nM) provided a constant hydrolysis rate over a periodof 1h with less than 20% conversion (Fig. 3D). To estimate thereproducibility of the assay, we measured the assay  Z   value using0.5nM recombinant vanin-1 and 1 l M pantothenate–AMC. Theno enzyme controls showed a background of 427±27U, and thevanin-1-added reactions showed a maximal signal of 2814±171U. The calculated S/B is 6.6, and the  Z   factor is 0.75 at a sub-strate-to-product conversion rate of 10% (Fig. 3E), which is wellwithin the range of an HTS-compatible assay. K  m  determination The  K  m  values for pantothenate derivatives have been reportedpreviously, although the  K  m  values appeared to be sensitive to as-say conditions. A  K  m  of 20 l M was reported for pantetheine usingnativepigvanin-1inTris bufferat pH9.0, whereasthe K  m  droppedto 5 l M at pH 5.0 in acetate buffer [14]. Also, a 2-fold drop in  K  m was observed in potassium phosphate buffer compared with thatin Tris buffer at the same pH of 7.5 with the same reducing agents[16]. The  K  m  for pantothenate–AMC was determined in phosphatebuffer B using 0.5nM vanin-1 enzyme, and the time courses of fluorescent changes at 460nm were linear within 60min of reac-tion time under the assay conditions used, as shown in Fig. 4A.Theslopesmeasuredfromlinearcurvefitting(Fig.4, R  =0.99)wereused as initial velocities, and the fluorescent signals were con-verted to mass concentrations (nM) based on the standard curvegenerated from a series of dilutions of AMC. In the fluorescentmeasurement, initial velocities at 30, 60, and 120 l M substrateconcentrations are essentially the same. Fitting of the initial veloc-ities to the Michaelis–Menten equation (0–30 l M substrate con-centration) yielded an apparent  K  m  value of 13±1 l M forpantothenate–AMC using the soluble recombinant human vanin-1 (Fig. 4B). Because fluorescent suppression at high substrate con-centration due to the inner filter effect has been reported previ-ously [20], we further corrected the inner filter effect by anorthogonal HPLC assay to monitor AMC production. In orthogonalHPLC assay, product AMCwas further measured by UV absorbanceat 355nm after HPLC separation. Initial velocities from the HPLCassay (Fig. 4C) were still linear but did not reach saturation at sub-strate concentration greater than 30 l M. Michaelis–Menten curvefitting (0–200 l M substrate concentration) of initial velocitiesfromHPLC assay showed an apparent  K  m  of 28±1.8 l Mfor panto-thenate–AMC (Fig. 4D). Considering the difference in assay condi-tions (e.g., buffer and enzyme source), an apparent  K  m  of 28 l M Fig. 2.  Pantothenate–AMC is a feasible substrate for vanin-1 HTS. (A) Reaction scheme of pantothenate–AMC hydrolysis catalyzed by vanin-1 to give pantothenic acid andAMC.(B)Fluorescenceemissionspectraofpantothenate–AMC( N )andAMC( j )onexcitationat340nm.(C)Timecourseofpantothenate–AMChydrolysisinthepresence( j )orabsence( h )ofvanin-1.(D)LC–MSanalysisofpantothenate–AMChydrolysisreactionsintheabsence(toppanel)orpresence(bottompanel)ofvanin-1.(E)Massspectrumofthepeakelutedat9.9min(Dtoppanel, pantothenate–AMC). (F)Massspectrumofthepeakelutedat1.6min(Dbottompanel, pantothenicacid). (G)Mass spectrumofthepeak eluted at 9.8min (D bottom panel, AMC).288  Assay for vanin tissue quantification/B.H. Ruan et al./Anal. Biochem. 399 (2010) 284–292
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks