Magazines/Newspapers

A functional G300S variant of the cysteinyl leukotriene 1 receptor is associated with atopy in a Tristan da Cunha isolate

Description
A functional G300S variant of the cysteinyl leukotriene 1 receptor is associated with atopy in a Tristan da Cunha isolate
Published
of 11
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Rapid communication 539 A functional G300S variant of the cysteinyl leukotriene 1receptor is associated with atopy in a Tristan da Cunha isolate Miles D. Thompson a,b , Vale´rie Capra f , Jun Takasaki g , Giovanna Maresca f ,G. Enrico Rovati f , Aurther S. Slutsky d , Craig Lilly h , Noe Zamel c ,W. McIntyre Burnham b , David E. Cole a and Katherine A. Siminovitch e Atopy is a well-defined immune phenotype that is reportedto be a risk factor for asthma. Among the many loci thatcontribute to a genetic predisposition to asthma, thecysteinyl leukotriene receptor genes and their variantshave been important subjects of study because they arefunctionally and pharmacologically implicated in the atopyphenotype affecting many asthma subjects. Moreover, theproduct of cysteinyl-leukotriene 1 receptor gene ( CysLT  1 ),located at Xq13.2, is targeted by LTreceptor antagonists. Inour earlier association study, the M201V variant of thecysteinyl-leukotriene 2 receptor gene ( CysLT  2 ), located at13q14,was implicated in atopic asthma. Here we report thescreening of the coding region of the  CysLT  1 , gene in thehighly asthmatic Tristan da Cunha population. In thispopulation, we discovered a CysLT 1  G300S variant thatis carried with a significantly higher frequency in atopicsand asthmatics from the Tristan da Cunha population.Furthermore, we report the asthma independentassociation of the CysLT1 G300S variant with atopy.Subsequently, we compared the changes conferred byeach SNP on CysLT function. The CysLT 1  300S receptorinteracts with LTD 4  with significantly greater potency. Forthe 300S variant, a statistically significant decrease in theeffector concentration for half-maximum response (EC 50 )for intracellular Ca 2+ flux and total InsP generation isobserved. Other aspects of the receptor function andactivity, such as desensitization, pharmacologic profile inresponse to montelukast, and cellular localization, areunchanged. These  in vitro  analyses provide evidence thatthe 300S CysLT 1  variant, found more commonly in atopicsin the Tristan da Cunha population, encodes a functionallymore sensitive variant.  Pharmacogenetics and Genomics 17:539–549   c  2007 Lippincott Williams & Wilkins. Pharmacogenetics and Genomics  2007,  17: 539–549 Keywords: asthma, atopy, cysteinyl-leukotrienes, endophenotype, genetics a Laboratory Medicine, Banting Institute, Departments of  b Pharmacology, c Medicine, University of Toronto,  d St Michaels Hospital,  e Departments ofMedicine, Immunology and Medical Genetics and Microbiology, University ofToronto, Samuel Lunenfeld and Toronto General Hospital Research Institutes,Toronto, Ontario, Canada,  f Laboratory of Molecular Pharmacology, DepartmentPharmacological Sciences, University of Milan, Milan, Italy,  g Astellas Pharma Inc.,Drug Discovery Research, Tsukuba, Ibaraki, Japan and  h Harvard Medical School,Pulmonary and Critical Care Division Brigham and Women’s Hospital, Boston,Massachusetts, USACorrespondence to Dr Miles D. Thompson, PhD, Department of Pharmacology,University of Toronto, Medical Sciences Building,Toronto, ON, Canada M5S 1A8Tel: +1 416 978 0779; fax: +1 416 971 2445;e-mail: miles.thompson@utoronto.ca Received  24 July 2006  Accepted  1 November 2006 Introduction  Asthma has often been reported to be present with atopy,a state of immune hypersensitivity that has a complex etiology and a significant degree of inherited suscept-ibility [1]. As such, atopy can be considered an asthmaendophenotype – a trait with a strong genetic componentthat confers risk for respiratory disease or altered drugresponse [2,3]. Atopy is characterized by an elevation of IgE immunoglobulins and/or inflammatory mediatorssuch as the cysteinyl-leukotrienes (cysteinyl-LTs), forexample LTC 4 , LTD 4  and LTE 4  [4]. Cysteinyl-LTs exertan important role in the acute and chronic manifestationsof asthma [4–8] and the significance of cysteinyl-LTs inthe clinical manifestations of asthma is demonstrated by the utility of targeting LT receptors in therapy [9–13].The increasing incidence of atopy and asthma reported in‘western’ populations [14] underscores the importance of identifying both environmental and genetic causes of asthma. The evidence for the genetic basis of atopy [1]that underlies asthma suggests the potential value of identifying sequence variation in exons that encodeproteins known to be involved in atopy, particularly of the LTsystem. This proposal is strengthened because inhumans, genes and proteins of the biosynthetic LT pathway have been found to be polymorphic [15] andevidence is accumulating that some of these geneticdifferences may influence the variability in patients’responses to therapy [16].Two candidate genes of interest are those encoding thecysteinyl-leukotriene 1 (CysLT  1 ) and cysteinyl-leuko-triene 2 (CysLT  2 ) receptors, activated by the cysteinyl-LT family of inflammatory mediators. These receptors areexpressed in cell types of particular relevance to asthmaand atopy, both in health and in disease [17].  CysLT  1 1744-6872   c 2007 Lippincott Williams & Wilkins Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.  receptor gene expression has been reported in humanlung smooth muscle cells, eosinophils and peripheralblood monocytes [18–20]. High levels of CysLT  2  receptormRNA expression have been detected in peripheralblood leukocytes [21–23] and in-situ hybridizationstudies with lung tissue show that, in contrast to CysLT  1 receptor, highest expression of the  CysLT  2   receptor geneis present in interstitial macrophages with much weakerexpression in smooth muscle cells [21]. Antagonists specific to the CysLT  1  receptor, such asmontelukast, zafirlukast and pranlukast, are among theLT modifying agents currently used in the therapy of asthma and allergic rhinitis [17,24,25]. By contrast, nospecific antagonists exist for the CysLT  2  receptor.Indeed, the only available antagonist targeting CysLT  2 receptor is Bay u9773, a low-potency ligand that alsoantagonizes the CysLT  1  receptor and shows partialagonist activity with CysLT  2  [22]. As has been the case for other asthma therapies, includingboth  b 2 -agonists and glucocorticoids, clinical studies of CysLT  1  receptor antagonists show a range of patientresponses to these drugs [10]. Variation in the genesencoding the LT receptors is one of the factors that may influence therapeutic response. For example, it has beennoted that CysLT  2  variants with altered responses to thepartial agonist action of Bay u9773 are associated with atopicasthma in some populations [26,27]. These data suggestthat the genetic basis of LT receptor drug ligand responsemay also confer altered disease risk in some individuals.Thus, the discovery that the  CysLT  2   receptor gene ispolymorphic [26] suggested that the  CysLT  1  gene openreading frame should be screened for sequence variants ina similar fashion. This approach furthered the analysis of the genetic contribution of both genes to atopy andasthma and the identification of CysLT  1  contribution toheritable variation in anti-LTefficacy.It has become clear that missense variants of the  CysLT  1 receptor gene are important in asthma because of theirassociation with other pathologic immunophenotypes. A  CysLT  1  927T>C variant seen in British and Spanishpopulations has been associated with atopy severity [28,29], whereas promoter polymorphisms that result inalternative splicing in the 5 0 untranslated region (5 0 UTR)have been associated with increased gene expression in vitro  [30,31]. In a Korean sample with aspirin-intoleranceasthma, three promoter single nucleotide polymorphisms(SNPs), (–634C>T, –75A>C and –336A>G) asso-ciated with the condition also show increased CysLT  1 expression  in vitro  [32].The studies reported here were conducted using samplesfrom the Tristan da Cunha population, along with smallerurban Caucasian American groups. Screening the Tristanda Cunha population for sequence variability in the CysLT  1  gene provided the opportunity to compare thevariability in the  CysLT  1  gene with that reported for the CysLT  2   gene [26]. The population residing on Tristan daCunha, isolated genetically and demonstrating foundereffects, has a 47% prevalence of asthma [3,33,34].Screening for SNPs identified a novel G300S variant of the CysLT  1  receptor and the M201V variant of theCysLT  2  receptor [26]. Along with the nonsynonymouspolymorphism reported in the db SNP database(rs17853465, AA position 272), these variants currently represent the only known functional exonic variants of the CysLT system of receptors. Methods Clinical samples Genomic DNA was extracted from the blood samplestaken from all participants as described previously [26].Phenol extraction and ethanol precipitation of DNA fromperipheral blood leukocytes [35], or from immortalizedlymphocytes, was conducted according to standard tissueculture and DNA extraction protocols (QIAamp BloodKit, Qiagen, Valencia, California, USA). Tristan da Cunha samples  A sample of 112 members of the island of Tristan daCunha, who had previously given written informedconsent, were screened for this study as describedpreviously [3,26,33,36]. When assessed for asthma status,these 112 individuals divided into a group of 54asthmatics and a group of 58 nonasthmatics. With respectto atopy status, the population was divided into a group of 52 atopics and a group of 60 nonatopics. Thus, mostatopics were also asthmatic. The average age of the 55men was 41 years and the average age of the 57 womenwas 42 years.The samples were collected in 1993 as part of theGenetics of Asthma research program at the University of Toronto [3,33,34]. Clinical histories were obtained by questionnaire and included recorded data on physiciandiagnosis of asthma, the presence of respiratory symp-toms (cough, sputum and wheezing), the presence of chest disorders including recent respiratory tract infec-tions, allergy history, asthmatic attacks including severity and precipitatory factors, other illnesses and smokinghistory [3,33,34]. A skin-prick test was used to assay for 15 commonallergens and controls (saline and histamine). Wheal sizeswere corrected by subtracting the diameter of the salinecontrol wheal. A corrected wheal size  Z 3mm (recorded10min after application) was recorded as positive 540  Pharmacogenetics and Genomics  2007, Vol 17 No 7 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.  [3,33,34] in 60 of the 112 persons screened from Tristanda Cunha. Spirometry The forced expiratory volume in 1s (FEV  1 ) was <70%,airway responsiveness was assessed by delivering 400 m gof salbutamol via metered-dose inhaler. Crudely speaking,an improvement in FEV  1  Z 15% at 15min was recordedas a positive response. Subsequently, a more refinedmeasure resulted from assaying the reversibility of methacholine-induced bronchoconstriction measured20min after the inhalation of 400 m g of salbutamol. Thisallowed the comparison of postbronchodilator FEV  1  withbaseline FEV  1  with respect to the mg/ml dose of methacholine that resulted in a 20% decrease in FEV  1 (PC20). Participants in the asthmatic group exhibitedsignificantly lower PC20 compared with the nonasthmaticgroup (2.41±0.20 vs. 8.90±0.87,  P  =0.003). Theevidence of reduced lung function was associated withbronchial hyperactivity in 74% of cases. In all studies,participants were asked to withhold bronchodilators atleast 8h before testing, while inhaled or systemic steroiddoses were maintained [3,33,34]. Sequence variant detection in the CysLT 1  receptor gene For the  CysLT  1  screen, variants were detected by acombination of single stranded conformational (SSCP)analysis and direct sequencing methods [37,38]. On thebasis of the known genomic structure, six sets of overlapping PCR primers were designed to screen the CysLT  1  receptor gene for variants among the Tristan daCunha population.The following oligonucleotide primers were used in thePCR/SSCP analysis of human  CysLT  1  gene in the Tristanda Cunha sample: LT1-1F, CGTAGGCCTAAGCTAACG;LT1-1R, GCCTTAAGCTATTATCCTGGAC; LT1-2F,GCGTAACCGTGGAACCATCG; LT1-2R, CACGACCGTATCCAATCCGAG; LT1-3F, GGCATACCTAGGCA TCATCC; LT1-3R, CAGCAGCCGATCTTACCTAC;LT1-4F, GGTCTTGCATTATGTGTCATTG; LT1-4R,GAAGGTGAATGGTACGTTG; LT1-5F, GTCAGTTTC ATGCCATATC; LT1-5R, GGTACATAAGTCACGCTGGAC; LT1-6F, GCTGGGGATTTTAAGGCTTT; LT1-6R, TCATTTGGAGACTACAAAG.PCR reactions used in the SSCP analysis used one of twomethods. The first (nonradioactive) protocol employed toscreen the Tristan da Cunha population made use of 200ng of human genomic DNA, 1 m g of each oligonucleo-tide primer, 2 m mol deoxynucleotide triphosphate,1.5mmol MgCl 2  and 0.5U of Taq polymerase. The PCR conditions were 5min at 95 1 C followed by 95 1 C for 30s,55–60 1 C for 40s and 72 1 C for 40s. Chain elongation wascontinued after the last cycle for 7min. PCR wasperformed using a PTC-100 Programmable ThermalController (MJ Research, Inc., Waltham, Massachusetts,USA). The amplified DNA was analyzed by agarose gelelectrophoresis before SSCP screening.The SSCP screening protocol required diluting PCR products 1:4 with an SSCP loading buffer. The bufferwas prepared by mixing stock denaturing solution withstock stop solution in a 2:3 ratio [39]. The denaturingsolution consisted of 0.1% sodium dodecyl sulfate and10mmol ethylenediaminetetracetic acid. The stop solu-tion consisted of 95% formamide, 20mmol ethylenedia-minetetracetic acid, 0.05% bromophenol blue and 0.05%xylene cyanole FF. Samples were denatured at 95 1 C for5min and chilled to 4 1 C for 5min before loading. Theentire volume of buffer and PCR product, 18 m l, wasloaded into separate wells of Novex 4–20% tris–boricacid–EDTA (TBE) gels [40,41] and run at 15 1 C using80V for 19h to resolve the PCR fragments. The DNA wasvisualized using the Novex SilverXpress Staining Kit(Uppsala, Sweden).The SSCP analysis was conducted as described above,except that the denatured PCR products were analyzedon a nondenaturing 0.5    MD polyacrylamide gel(BioProducts, Rockland, Maine, USA) according to themanufacturer’s protocol. Gels were run at 40W at 4 1 C,dried and exposed to X-ray film as required.For analysis by direct sequencing, PCR products werepurified by the QIAquick, PCR purification method(Qiagen, Valencia, California, USA) and bidirectionally sequenced on an ABI Prism 377 sequencer. Genotypeswere assigned, as described previously, using Genescan2.1 and Genotype 2.0 software (PE Applied Biotechnol-ogies, Foster City, California, USA) [42]. Statistics The primary statistical analysis used general linearmodeling to examine the contribution of the CsyLT variants to atopy and asthma in the population of Tristanda Cunha. Genotypes were coded ordinally (0, 1, 2) sothat only codominant and dominant allelic effects wereconsidered. Because the  CysLT  1  gene is located on the X chromosome, a weighted calculation was used to estimateallele frequency in the total sample of men and women.Covariates analyzed included sex and cigarette smoking.Differences in allele distribution between groups, includ-ing comparisons made between atopics and nonatopicsfrom Tristan da Cunha were tested by Fisher’s exact test,and  P  <0.05 was considered statistically significant [43]when testing association of SNP markers on thecandidate gene with a disease phenotype [26].Independence of allele associations with phenotypes wasalso tested by two-way analysis of variance using Functional CysLT 1  variant and atopic asthma  Thompson  et al.  541 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.  SigmaStat Statistical Software 2.0 (Jandel Corporation,San Rafae, California, USA). The differences in overall CysLT  1  allele distribution between groups, includingcomparisons made between atopics and nonatopics fromTristan da Cunha were examined, and the asthma-independent association of the G300S  CysLT  1  receptorgene variant with atopy was tested. When testingassociation of SNP markers on the candidate gene witha complex phenotype [26], as applied previously [44,45], P  <0.05 is considered statistically significant [43].The odds ratio (OR, unadjusted for kinship) for atopy andasthma for the G300S carrier was also calculated with95% confidence intervals. The power analysis of the study was estimated using freeware QUANTO version 5.1(University of Southern California,  http://hydra.usc.edu/gxe  ),as reported previously [43]. Generation of variant CysLT 1  constructs The  CysLT  1  receptor gene was subjected to site-directedmutagenesis to introduce the 899G>A and 617T>Gnucleotide substitutions that encode the G300S andI206S peptide variants. Briefly, the full-length cDNA of the wild-type  CysLT  1  receptor gene was cloned into themammalian expression vector pcDNA  3  (Invitrogen,Carlsbad, California, USA). This construct became thetemplate for site-directed mutagenesis using the Trans-former site-directed mutagenesis kit (Clontech, Palo Alto, California, USA). Mutagenic primers were used inconcert with selection primers designed to eliminate aunique  Apa  I restriction enzyme site (located at the 3 0 region of the vector) or a unique  Not  I restriction site(located 5 0 of the vector). The products from the T4DNA polymerase-T4 DNA ligase reaction were digestedwith the enzyme corresponding to the selection primerboth before and after transformation into  Escherichia coli  .Clones lacking the unique restriction site were selectedfor dideoxy sequencing of both strands to confirm theincorporation of the desired nucleotide substitution. Themutated CysLT  1  receptor cDNAs were then subclonedinto the pEF-BOS expression vector (Invitrogen) withsignal sequence and FLAG tag. This vector has acleavable membrane insertion signal sequence frominfluenza hemagglutinin that is coupled with the FLAGepitope at the N-terminus. The sequence of the full-length mutated cDNA and its orientation into the pEF-BOS expression vector (Stratagene, La Jolla, California,USA) were confirmed by sequencing. The coding regionvariants of the  CysLT  1  receptor gene sequences wereverified. Culture and transfection of cells Cells were cultured in Dulbecco’s modified Eagle’smedium (DMEM) supplemented with 10% fetal bovineserum (FBS), 50U/ml penicillin, 100 m g/ml streptomycinand 20mmol/l  N  -2-hydroxyl piperazine-  N  0 -2-ethanesulfonic acid buffer pH 7.4, at 37 1 C in a humidifiedatmosphere of 95% air and 5% CO 2 . COS-7 cells wereplated out to a convenient dilution to obtain a 50–60%confluence on the day of transfection into 12-well tissueculture dishes [total inositol phosphate (InsP) formationassay] or 12-mm diameter glass coverslips ([Ca 2+ ] i measurement, confocal microscopy), previously coatedwith poly- D -lysine 5 m g/ml, as described before [46].COS-7 cells were transiently transfected as previously described [46] using Lipofectamine 2000 (Initrogen,Carlsbad, California, USA) according to the manufac-turer’s instructions. Briefly, cells were incubated with theDNA/lipofectamine mixture (1:3 ratio, 0.125mg/cm 2 )for 24 ([Ca 2+ ] i  measurement, confocal microscopy) or48h (total InsP formation assay) and the media replacedimmediately before the challenge. Characterization of CysLT 1  variants: fluorescence cal-cium-imaging functional assay The calcium flux assay was conducted using Fluo3-AMcalcium indicator dye (Molecular Probes, Eugene, Ore-gon, USA) to measure calcium flux in response to thecysteinyl LTs C 4 , D 4  and E 4 . Cells were transiently transfected with the  CysLT  1  wild-type receptor gene andthe two variants using Lipofectamine 2000. After 18h,cells were plated into 96-well plate at 5  10 4 cells perwell.Briefly, the calcium flux assay was conducted as follows. After 24h, the cells were loaded with Fluo3-AM for 1h. After washing, the cells were stimulated with variousconcentrations of LTs. LTD 4 -induced calcium mobiliza-tion in cells expressing G300S variants and I206S variantswas compared with CysLT  1  wild-type. Maximum fluor-escence levels were measured in a Molecular DevicesFluorometric Imaging Plate Reader [47] as reportedpreviously [26,41].The concentration–response curves of calcium flux wereanalyzed and plotted using PRISM software (GraphPad,San Diego, California, USA). Evaluation of the statisticalsignificance of the parameter difference was based on the F- test for the extra sum of squares principle [48]. P  <0.05 was considered statistically significant. Total inositol phosphate determination Production of total InsPs was measured as previously described [49]. Confluent COS-7 cells were labelled with1 m Ci of myo-[2- 3 H]inositol (17Ci/mmol) for 18h inserum-free, inositol-free DMEM containing 20mmol/l  N  -2-hydroxyl piperazine-  N  0 -2-ethane sulfonic acid buffer,pH 7.4 and 0.5% (w/v) Albumax I. Forty-eight hours aftertransfection, cells were incubated with serum-free,inositol-free DMEM containing 25mmol/l LiCl for10min at 37 1 C and then incubated with increasing 542  Pharmacogenetics and Genomics  2007, Vol 17 No 7 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.  concentrations of LTD 4  (100nmol/l–1 m mol/l). After30min at 37 1 C, the reaction was stopped by aspirationof the supernatant and the addition of 0.75ml of 10mmol/l formic acid. After 30min of incubation at roomtemperature, the solution was collected in 3ml of 5mmol/l NH 4 OH (pH 8–9) and separated with40mmol/l ammonium formate/formic acid buffer, pH 5.Total InsPs were eluted with 4ml of a 2mol/l ammoniumformate/formic acid buffer, pH 5, of which 250- m l aliquotswere counted by liquid scintillation. The concentration–response curves of total InsPs were analyzed and plottedusing PRISM software (GraphPad). Evaluation of thestatistical significance of the parameter difference wasbased on the  F- test for the extra sum of squares principle[48].  P  <0.05 was considered statistically significant. Confocal microscopy of intact COS-7 cells Twenty-four hours after transfection, COS-7 cells wereanalyzed by confocal microscopy as previously described[46]. Monolayers on coverslips were washed withphosphate-buffered saline, fixed with paraformaldehydeand permeabilized with 0.1% Triton X-100. Cells wereincubated with 2% bovine serum albumin as blockingsolution and with antibody against the C-terminus of CysLT1 receptor (1:250v/v) for 1h at room temperature,then were washed and incubated with Alexa 488 goatanti-rabbit antibody (1:250v/v) for 45min. Cells werewashed with phosphate-buffered saline and with Tris-HCl 10mmol/l pH 7.4 and incubated with Sytox Orange(1:25000 v/v) for 15min. Confocal laser scanningmicroscopy was performed using a Bio-Rad (Hercules,California, USA) confocal microscope (Radiance 2100equipped with a   100/  60 lens). Results Variants of CysLT 1  discovered by SSCP-sequenceanalysis Heterozygosity on SSCP screen, confirmed by sequen-cing, demonstrated 899G>A (below) and 617T>G(data not shown) transitions putatively coding for G300Sand the I206S missense variants, respectively, of theCysLT  1  receptor. The previously reported variants of the CysLT  2   gene that encodes the inactivating M201V variantand the activating R315K CysLT  2  variant were alsoidentified [26] as shown in the alignment of the receptorproteins (Fig. 1). Frequency analysis The CysLT  1  300S variant was more common in theatopics and asthmatics from Tristan da Cunha. TheCysLT  1  variant, 300S, was found at a significantly higherfrequency in the atopic members of the Tristan da Cunhasample (Tables 1–3). Among asthmatics, the 300S allelefrequency was also higher in asthmatics (9%) comparedwith nonasthmatics (5%) from Tristan da Cunha. Only females from Tristan da Cunha, however, were statisti-cally more likely to carry to 300S variant (Tables 4–6).Perhaps as a result of this consideration, only 64% of asthmatics carried the 300S minor allele. The 206Svariant was not found at higher frequencies among any group of asthmatic and/or atopics compared with controls(Table 7).The frequency of the CysLT  1  300S variant was 15% (25/167 chromosomes) in the Tristan da Cunha sample. Withinthe group of atopics, 80% carried the minor 300S allele.The OR (unadjusted for kinship) for atopy in a 300S carrierwas more than six-fold higher (OR=6.28; 95% confidenceinterval: 2.2–17.7,  P  <0.0001) than in participants withonly the wild-type G300 allele. This comparison was foundto be highly significant by Fisher’s exact test (Table 3).Stratification by sex suggested that most of the risk wasattributable to the heterozygous women (16/57 carriersfor an OR=4.0; 95% confidence interval: 1.2–13.3). TheCysLT  1  G300S SNP was highly correlated with atopy ( r  =0.35,  P  <0.001) as well as asthma ( P  =0.005; two-way analysis of variance) among women from the Tristanda Cunha sample.This association was unchanged when general linearmodeling was used to correct for sex and cigarettesmoking covariates. The power analysis calculations wereperformed as previously described [43] with respect tothe novel CysLT  1  variants. We estimated that our study has approximately 80% power to detect a relative risk of 1.73 conferred by the 899G>A genetic variant thatencodes the 300S, the ‘exposure’ value, in which theparameters were [ a ]=0.05 and 1–[ b ]=0.80. Functional and pharmacological characterization ofCysLT 1  receptor variants Calcium mobilization Functional coupling of CysLT  1  receptor variants followingagonist stimulation was initially assessed by measuringthe classic signaling through elevation of intracellularcalcium ([Ca 2+ ] i ). Cells transiently expressing the wild-type CysLT  1  receptor and the 300S or 206S variants wereassayed to define: (i) the basic characteristics and thespecificity of the response (Fig. 2) and (ii) the responseto log unit increases in LTD 4 , allowing the determinationof receptor sensitivity, as measured by effector concen-tration for half-maximum response (EC 50 ) (Fig. 3a).Cells transiently transfected with wild-type CysLT  1 receptor or 300S or 206S receptor variants respondedwith a rapid and transient increase in [Ca 2+ ] i  (Fig. 2d–f),consistent with previous results obtained in heterologousexpression systems [46]. Cells transfected with 300S and206S alleles responded to 1 m mol/l LTD 4  with an increasein [Ca 2+ ] i  of 1.71-fold (±0.04 SE,  n =6) and 1.8-fold(±0.12 SE,  n =6), respectively, compared with 1.8-fold(±0.07 SE,  n =12) for the wild-type receptor. Mock  Functional CysLT 1  variant and atopic asthma  Thompson  et al.  543 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks