Real Estate

A general method for chimerization of monoclonal antibodies by inverse polymerase chain reaction which conserves authentic N-terminal sequences

Description
Chimerization of antibodies (Ab) by cloning the V (variable) regions encoding the light and heavy chains with degenerate oligodeoxyribonucleotide primers matching to framework region 1 and to the joining regions, leads to Ab with altered amino acids
Categories
Published
of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Gene, 122 (1992) 321-328 Q 1992 Elsevier Science Publishers B.V. All rights reserved. 037%1119/92/$05.00 321 GENE 068 17 A general method for chimerization of monoclonal antibodies by inverse polymerase chain reaction which conserves authentic N-terminal sequences (Recombinant DNA; primer mutagenesis; interleukin-2 receptor; PCR; chimeric antibody engineering; mammalian expres- sion vectors) Brigitte Kaluza a, Gisela Betzl”, Hui Shaob, Tibor Diamantsteinb and Ulrich H. Weidle” n BoehringerMannheim GmbH, Department ofBiotechnology, D-8122 Penzberg, Germany, and b Institutftir Immunologic, Freie Universitiit Berlin, W-1000 Berlin 45, Germany. Tel. 49-30) 7983639 Received by H.G. Zachau: 11 June 1992; Revised/Accepted: 11 August/l2 August 1992; Received at publishers: 27 August 1992 SUMMARY Chimerization of antibodies (Ab) by cloning the V (variable) regions encoding the light and heavy chains with degener- ate oligodeoxyribonucleotide primers matching to framework region 1 and to the joining regions, leads to Ab with altered amino acids at the N-terminus compared to those of the parental Ab. This is due to N-terminal framework 1 sequences in the expression vectors [Larrick et al., Bio/Technology 7 (1989) 937-938; Le Boeuf et al., Gene (1989) 371-377; Orlandi et al., Proc. Natl. Acad. Sci. USA 86 (1989) 3833-38371. This might lead to Ab with altered affinity to the antigen due to interaction of framework sequences with complementarity determining regions. Moreover, some V regions may be re- fractory to cloning by this procedure. Here, we describe a method to circumvent these potential problems. The V regions for both chains of the Ab are cloned by inverse polymerase chain reaction (PCR) with primers matching the known con- stant region sequences of the Ab. After sequencing, PCR fragments corresponding to the V regions of both chains are in- serted in-frame into appropriate expression vectors leading to Ab with unaltered N-terminal sequences after expression in mammalian cells. The procedure is illustrated with an Ab directed against the p chain of the human interleukin-2 receptor. INTRODUCTION The major problems in treatment of patients with murine mAb are immunogenicity and ineffective recruitment of ef- fector functions due to a suboptimal isotype (reviews in Longo, 1987; Chatenoud, 1986). Rendering the foreign Ab Correspondence to: Dr. U.H. Weidle, Department of Biotechnology, Boehringer Mannheim, GmbH, Nonnenwald 2, Postfach 1152, D-8122 Penzberg, Germany. Tel. (49~8856)602801; Fax (49~8856)602659. Abbreviations: A., absorbance (1 cm); aa, amino acid(s); Ab, anti- body(ies); ABTS, 2,2’ azido-di(3-ethylbenzthiazoline-sulfonate-6); Ap, ampicillin; ApR, gene conferring resistance to Ap; bp, base pair(s); BSA, bovine serum albumin; C, constant region; cDNA, DNA complementary to mRNA; CDR, complementarity determining region(s); D, diversity region; ELISA, enzyme-linked immunosorbent assay; FR, framework re- more similar to those of the host might curb or even elim- inate those problems. For this purpose chimeric mAb, in which the xeno-V regions are combined with human con- stant regions (Morrison et al., 1984) and humanized mAb (Junghans et al., 1989), in which only the small xeno-CDR which mediate epitope recognition are transferred into gion of variable part of Ab; H, heavy chain; Ig, immunoglobulin; IL2, interleukin 2; IL2R, IL2 receptor; J, joining region; kb, kilobase or 1000 bp; K,, binding constant; L, light chain; L,, part of leader sequence encoded by the first exon of Ig genes; L,, part of leader sequence encoded by the VJ or VDJ exon of Ig genes; L,VJ, exon of Ig genes consisting of rearranged V region of L chain; L,VDJ, exon of Ig genes consisting of rearranged V region of H chain; mAb, monoclonal Ab; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; PBS, phosphate-buffered saline (0.15 M NaCl/lO mM Na,phosphate pH 7.5); PCR, polymerase chain reaction; UT, untranslated region; V, variable region.  322 human sequences for the L and H chain (Riechmann et al., 1989) have been constructed and are currently under in- tensive investigation. Cloning of the V regions determining the specificity of the mAb and insertion of these gene segments into suitable expression vectors are the steps necessary for the construc- tion of chimeric mAb. The first step, cloning of the V regions, has been greatly facilitated by the PCR. Most techniques start from mRNA and make use of the similarity of Ab V regions (Kabat et al., 1987) which makes the design of degenerate primers for PCR amplification possible (Larrick et al., 1989; Orlandi et al., 1989; Le Boeuf et al., 1989). However, the unbiased amplification of complete V repertoires requires very com- plex sets of degenerate primers (Marks et al., 1991). The cloning of V regions with very untypical sequences might still not be possible by this approach. Moreover, the src- inal sequence will be lost in those parts that are covered by the primers. The aa in these regions seem to contribute to the correct folding of the CDR regions (Chothia et al., 1989). For this reason, V-region cloning by use of degen- erate primers could lead to reduced Ab affinity. In the second construction step of recombinant Ab, the cloned V regions are combined with the desired C regions in an expression vector. The insertion of V regions cloned from mRNA into such vectors can be achieved by restric- tion endonuclease sites incorporated into the sequence of the V(D)J region. These are derived from the degenerated primers used for PCR amplification. The srcinal aa se- quence in FRl and FR4 will, however, be altered by this procedure. Alternatively, in cases where the mRNA se- quence including the 5’ UT regions of the parental rodent antibody is known, the functionally rearranged genomic DNA can be amplified by PCR and inserted into expres- sion vectors using restriction endonuclease sites within in- trons and the 5’ UT region (Weissenhorn et al., 1991). This procedure leads to unaltered Ab sequences, but is comparatively time-consuming. Here, we describe a cloning method and a set of expres- sion vectors that allow the direct cloning of Ig V regions from mRNA and their expression in lymphoid cells with- out any alterations of their aa sequence. The method is demonstrated with the murine mAb A41 directed against the /3 chain of the human IL2R which was made chimeric (IgGl, K) by this procedure. RESULTS AND DISCUSSION a) Properties of mAb A41 The high-afhnity IL2R is composed of at least two chains, the CI hain (~55, Tat) and the Bchain (~75). It is selectively expressed on activated T-cells, therefore mAb directed heavy chain gene light chain gene P L,LYDJ E C, C, C, C, C,C, P L,L&‘J E C L,L ’ K’) J 5’ i_&,Ad’ mRNA V CD) cyclic c-DNA 1 inverse PCR (A) L,Ls D)JAC -AA,- 1 CR (6) L&’ W J “L restr,ct,on ndonuclease cleavage AL,V D) J Fig. 1. Schematic representation of the cloning procedure for chimeriza- tion of mAb. mRNA encoding Ab L and H chains is transcribed by re- verse transcriptase into double-stranded cDNA, which is then circular- ized by ligation. Subsequently, inverse PCR amplification [PCR(A)] is performed with primer pairs (Table I) which anneal to the constant and 3’.UT regions of the c-DNA for L and H chains. The resulting amplili- cation product contains the 5’-UT region, the leader sequence, the com- plete V region, and is flanked by 3’-UT and C region sequences. The nt sequence of the amplification product is determined and used for the design of primer pairs for PCR(B). The first primer matches the L, region (the part of the signal sequence which is encoded within exon 2 of Ig L and H chain genes) and the 5’ part of the V region. This primer introduces a restriction site into L, (for details see Table I). The second primer matches the 3’ part of the V(D)J region and ends exactly at the last nt of exon 2 (for details see Table I). The DNA fragment obtained by PCR(B) is cut with the appropriate restriction endonuclease to obtain a cohesive 5’ end and then ligated into the expression vector. The vectors (Figs. 3 and 4) contain a chimeric L- or H-chain Ig gene. Restriction sites for bluntly cutting enzymes (SnaBI or BbrPI) are located exactly on the splice site between exon 2 and intron 2. A restriction site matching the cohesive end of the L,V primers is located within L, of the Ig genes on the vectors. Thus, insertion of the amplified and recut product of PCR(B) reconstitutes the srcinal genomic organisation of the Ig genes on the vectors without altering any aa of the V regions. Boxes represent exons, circles indicate enhancer elements, and thin lines U7 regions and intron sequences. P, promoter; L, and L,, leader sequences encoded by two different exons; E, enhancer; V, variable region; D, diversity region; C, constant region; C,, exon of constant region. against its constituents are of potential interest for immu- notherapy of graft-vs.-host reactions and autoimmune dis- eases (reviewed in Diamantstein et al., 1989). A hybridoma cell line secreting mAb 41 was obtained by standard cell  fusion techniques (Kiihler and Milstein, 1975) with the NK-like cell line YT, subclone 2C8 (Takeshita et al., 1989) as immunogen. This cell line expresses the /? chain of IL2R in absence of the X chain. A41 (isotype IgGl,rc) inhibits binding of IL2 to the /? chain of IL2R. With respect to epitope recognition, two groups of mAb directed against the p chain have so far been described: Mik/Pl and TU27 (Tsudo et al., 1989), which compete for the same epitope and inhibit IL2 binding, and Mik/j?3 (Tsudo et al., 1989) which does not block IL2 binding to the j? chain. Competition experiments have revealed that mAb A41 recognizes the same epitope as mAb Mik//?l and TABLE I Primers used for amplification of VJ and VDJ regions of antibody A41 TU27. We have determined the affinity constant of mAb A41 by usage of radiolabeled mAb (unpublished observa- tions). The K, = 0.26 x lo- 9 M indicates about tenfold im- proved binding to the /? chain compared to mAb Mik/j?l and Mik/P3 (Tsudo et al., 1989). This finding points to the possibility to use mAb A41 together with a mAb directed against the a chain of the IL2R as a potential agent for synergistic inhibition of T-cell proliferation. b) Cloning of the DNA encoding V regions of mAb A41 The cloning procedure for expression of chimeric mAb with authentic N-terminal aa is displayed in Fig. 1. In the Primer A inverse PCR)= Primer Al (K C) 5’-CCC CGA ATT CGA GGC TTC CCC ACA AGC GAC CTA CCA CTG TT-3’ 41mer Primer A2 (IC 3’-UT) 5’-CCC CAA GCT TGG AAG ATG GAT ACA GTT GGT GCA GCA TCA GC-3’ 41mer Primer A3 (yll CHl) 5’-GGG GGA ATT CCA TAC TGA GA A GAG CCT CTC CCA CTC TCC TG-3’ 41mer Primer A4 (yl 3’ UT) 5’-GGG GAA GCT TGG GGC CAG TGG ATA GAC AGA TGG GGG TGT CG-3’ 41mer Primer Bb Primer Bl (K L2) 23mer Primer B2 (K J) 20mer Primer B3 (yl L2) 28mer Primer B4 (yl J) 20mer 5’-AGC CTC TCG AGG TGA CGT CTT GC-3’ 5’-GTT TAA TTT CCA GCT TGG TC-3’ 5’-TGC AGG TGT GCT CAG CGA GGT CCT GCT G-3’ 5’-CTG AGG AGA CGG TGA CTG AG AG-3’ Primer Cc Primer Cl (7c V) 24mer 5’-GAT ATC GAT ATC GTG ATG ACC CAG TCT CCA-3’ Primer C2 (K J) 22mer Primer C3 (yl V) 22mer 5’-GTT TCA GCT CGA GCT TGG TCC C-3’ 5’-AGG T(CG)C AGC TG(CG) (AT)G(CG) AGT C(AT)G G-3’ Primer C4 (“~1 J) 30mer 5’-TGA GGA GAC GGT GAC CGT GGT CCC TTG GCC CCA G-3’ a Primer set A is used for inverse PCR of V regions and can be used for all murine K (Al, A2) and yl (A3, A4) genes. Primer Al is annealing to C,; primer A2 matches the 3’-liT region of the murine K gene. Analogously, primer A3 hybridizes to Cyl and primer A4 to the 3’-UTregion of the yl gene. Restriction sites (EcoRI or HindIII) are shown in bold type. b Primer set B is used for amplification of Ig gene segments obtained by inverse PCR (primer set A) for insertion into expression vectors (Fig. 1). Primers Bl and B2 are specific for the L chain, primers B3 and B4 for the H chain of mAbA41. The sequence segments homologous to these primers are shown in Fig. 2. The XhoI site of primer Bl and the C&I site of primer B3 are shown in bold type. ’ Primer set C contains primers for PCR amplification of V regions according to Orlandi et al. (1989). These experiments were performed for reasons of comparison. Primer set C contains primers annealing with murine K (Cl and C2) and heavy chain (C3, C4) V regions. EcoRV, XhoI, PvuII and BstEII restriction sites are shown in bold type. a, b, ’ The letters in parentheses indicate the Ab chain and the part of the V region to which the primers are matched. C, constant region; CHl, part of the constant region corresponding to exon 1; V, variable region; J, joining region. L,, part of the leader sequence en- coded by the second exon of Ig genes.  324 A. am b m cdm efm 2 1 kb 1 kb 0 6 kb 0 4 kb 0 3 kb 0 15 kb B 61 <<3'UT<<>>5'DT>>. AGCCCTCTGGTCCTACAGGACTCTGA~ACCTACCTCCACCCCTC~~GACACTG~CAC TCGGGAGACCAGGATGTCCTGAGACTGTGGATGGAGGTGGTGGGGAGGTGTCTGTGACTTGTG 121 ACTGACTCTAACCATGGAATGGAGCTGGATCTTTCTCTTTCTCC~TCAGG~CTG~GG TGACTGAGATTGGTACCTTACCTCGACCTAGAAAGAGAG~GA~ACAGTCCTTGACGTCC MetGluTrpSerTrpIlePheLeuPheLeuLeuSerGlyThrAlaGl -19 -5 181G AGC TGTCCTCTCTGAGGTCCAGCTGCAACAGTTTGGAGCTGAATT~ ACAGGAGAGAGACTCCAGGTCGACGTTGTCAFLACCTCGACTT~C~CTTCGGACCCTGMG yValLeuSerGluValGlnLeuGlnGlnPheGlyAlaGluLeuValLysProGlyThrSe 1 16 241 GGTGAAGATATCCTGCMGGCTTCTGGCTA~TTTT~CTGACTACM~TGGACTGGGT CCACTTCTATAGGACGTTCCGAAGACCGACCGA~T-GTGACTGATGTTGTACCTGACCCA rValLysIleSerCysLysAlaSerGlyTyrI1ePheThrAsaTvrAsnMetAsuTrpVa 36 301 GAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATAT~ATCCT~CTTTGATA~ CTTCGTCTCGGTACCTTTCTCGGAACTCACCTAACCTCTAC lLysGlnSerHisGlyLysSerLeuGluTrpIleGlyAsuIleAsuPro~nPheAs~Se 56 361 TTCCAGTTACMCCAGAAGTTCMGGG~GGCCACATTGACTGTAGA~GTCCTC~ PAGGTCAATGTTGGTCTTCATTCCCTTTCCGGTGTAAGTT rSerSer~rAsnGlnLvsPheLysGlyLysAlaThrLeuThrValASpLySSerSerAs 76 421 CACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACC GTGTCGGATGTACCTCGAGGCGTCGGACTGTAGACTGTAGACTCCTGTGACGT~GAT~TGACACG nThrAlaTyrMetGluLeuArgSerLeuThrSerGluASpThrAlaValTyrTyrCysA1 96 481 AAGAGGGGGATTCCCCTATGTATGGACTACTGGGGTCAACCGTCT~ TTCTCCCCCTAAGGGGATACCATACCTGATGACCCCAGTTCCTTGGAGT~GTGGCAGAG aArgGlvGlvPheProT~rGlyMetAsT3TyrTrpGlyGlnGlyTh~SerVal~rValSe 116 541 CTCAGCCA?&CGACACCC&ATCTGTCT~TCCACTGGC&CAAGCTT GAGTCGGTTTTGCTGTGGGGGTAGACAGATAGGTGACCGGGGTTCGAA rSerAlaLysThrThrProProSerVal~rProLeuAlaPro. >xonstant region>> C 1 GAATTCGAGGCTTCCCCACACGACCTACCACTGTTGCGGTGCTC~CCTCCTCCC~ CTTMGCTCCGMGGGGTGTCGCTGGATGGTGACAACGCGGG 61 <<3'UTc<>>leader>> . TC ACCTCCTTTTCCTCCTCCTCCCTTTCCTTGGCTTTTTGCTTTCTTGGATT~CAGCCTCCA TGGAGG-GGAGGAGGAGGGAAAGGAACCGAAAAA CGAAAGAACCTAAGGTCGGAGGT . . ..LeuLeuSerTrpILeProAlaSerA -10 121 GAGGTGACGTCTTGCTGACTCAGTCTCCAGCCATCCTGT CTCCACTGCAGAACGACTGAGTCAGAGGTCGGTAGGACAGCTC rgGlyAspValLeuLeuThrGlnSerProAlaIleLeuSerValSerProGlyGluArgV 1 18 181 TCAGTTTCTCCTGTAGGGC~GTCAGAGCATTGGClACAA AGTCAAAGAGGACATCCCGGTCAGTCTCGTAACCGTGTGTTCGTATGTGACCATAGTCGTTT alSerPheSerCysArsAlaSerGlnSerIleGlyThrSerIleHisTrpTyrGlnGlnA 38 241 GAACAAATGGTCCTCCAAGGCTTCTCATAAAGTATGCGTCTGAGT~TCTCTGGGATC~ CTTGTTTACCAGGAGGTTCCGMGAGTATTT~TACGCAGACT~GTTAGAGACCCTA~ rgThrAsnGlyProProArgLeuLeuIleLysTvrAlaSerGluSerIleSerGlyIleP 58 301 CTTCCAGGTTTAGTGG~GTGATCAGGGACAGATTTTAC~ GAAGGTCCAAATCACCGTCCTAGTCCCTGTCT-TGAG~TCGTAGTCGTCACACC roSerArgPheSerGlySerGlySerGlyThrAspPheThrLeuSerIleSerSerValG 78 361 AGTCTGAAGATATTGCAGATTATTACTGTCAACAAACTAACCACGTTC~ TCAGACTTCTATAACGTCTMT~TGA~GTTGTTTGATTATCGACC~TTGGTGCMGC 1uSerGluAspIleAlaAspTyrTyrCysGlnGlnThrAS~SerThrPheG 98 421 GAGGGGGGACCMGCTGGAAATTAAACGGGCTGATGCTGCACC~CTGTATCCATCTTC~ CTCCCCCCTGGTTCGACCTTTAATTTTGCCCGACTACGACGTGGTTGACATAGGTAG~GG lyGlyGlyThrLysLeuGluI1eLysArgAlaAspAlaAlaProThrValSerIlePhe. >xonstant region>> 118 481 AAGCTT TTCGAA D. 1 GAATTCGAGGCTTCCCCACACGACCTACCACTGTTGCG CTTMGCTCCGAAGGGGTGTTCGCTGGATGGTGACAACGCGGG 61 . <<3'UT<c>>S'UT>> . ACCTCCTTCTCCTCCTCCTCTCTTCCAGCTCTCAGAGATGCTCCTGTT TGGAGGMGAGGAGGAGGAGAGAAGGTCGAGAGTCGAGAGTCTCTACCTCTGTCTGTGTGAGGACM MetGluThrAspThrLeuLeuLe -20 121 ATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACATTGTGCTGACACAGTCTC~ TACCCATGACGACGAGACCCGTCCPAGGTGACCACTGAC~ACTGTM~CGACTGTGTCAGAGG uTrpValLeuLeuLeuTrpValProGlySerThrGlyAspIleValLeuThrGlnSerPr 1 7 181 TGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCACCATCT~TACAG~CCAG~~ ACGAAGGMTCGACATAGAGACCCCGTCTCCCGGTGGTAGAGTATGTCCCGGTCGTTTTC oAlaSerLeuAlaValSerLeuGlyGlnArgAlaThrIleSerTyrAr~AlaSerL~sSe 27 241 TGTCAGTACATCTGGCTATAGTTATATGCACTGGAACCAAC~ ACAGTCATGTAGACCGATATCAATATATACGTGACCTTGGTTGTCTTTGGTCCTGTCGGTGG rValSerTh~SerGlvTvrSerTYrMetHisTrpAsnGlnGlnLysProGlyGl~P~OPr 47 301 CAGACTCCTCATCTATCTTGTATCCAACCTAGAATCTGGGTCCCTGC~GGTTCAGTG~ GTCTGAGGAGTAGATAGMCATAGGTTGGATCTTAGACCC~GGGACGGTCC~GTCACC oArgLeuLeuIleTyrLeuValSerAsnLeuGluSerGlyValProAlaArgPheSerG1 67 361 CAGTGGGTCTGGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGA~ATGCTG~ GTCACCCAGACCCTGTCTGAAGTGGGAGTG~AGTTGTAGGTAGGACACCTCCTCCTCCTACGACG ySerGlySerGlyThrAspPheThrLeuAsnIleHisProValGluGluGluAspAl~l 87 421 PACCTATTACTGTCAGCACTAGGGAGCTTACACGTTCGGA~~GGACC~GCTGG~ TTGGATAATGACAGTCGTGTAATCCCTCCCTCG~~TGC~GCCTCCCCCCTGGTTCGACCTT aThrTyrTyrCysGlnHisIleArqGluLeuThr..PheGlyGlyGlyThrLysLeuGlu 107 481 AT-CG&CTGATGCTGACCAACTGT~TCCATCTTC&AGCTT TATTTTGCCCGACTACGACGTGGTTGACATAGGTAGAAGGTTCGAA IleLysArgAlaAspAlaAlaProThrValSerIlePhe.. >>constant region>,  first step, the L,L,VJ and L,L,VDJ regions of the L and H chain of mAb A41 were amplified by inverse PCR with circularized cDNA derived from mRNA of the hybridoma cell line as a template. Only primers matching known Ig gene sequences are used (C region and 3’ UT region of L and H chain; primers Al, A2, A3 and A4; see Table I for details). Amplified DNA is subsequently subcloned and sequenced. As there was no selection for full-sized cDNA during our procedure, smaller molecules will amplify as well during PCR (A). Also, concatemeric templates can be formed as side products of the ligation reaction. For these reasons, the expected fragments are accompanied by a smear of over- and undersized fragments from which they were separated by agarose gel electrophoresis and sub- cloned (Fig. 2A, lanes a and b). For comparison, amplifi- cation products with degenerate primers (Orlandi et al., 1989; Table I, primers Cl, C2, C3, C4) are shown (Fig. 2A, lanes c, d, e and f). While our work was in progress, a method for cloning T-cell receptor variable sequences by inverse PCR was described (Uematsu, 1991). Attempts have been made to create a second primer-binding site by adding a known sequence at the unknown end of the cDNA (Frohman et al., 1988; Loh et al., 1989; Ohara et al., 1989; Zauderer 325 and Natarajan, 1990). The principle of anchored PCR (Loh et al., 1989) is the attachment of a homopolymeric DNA tail to the cDNA end. A critical step is the efficient removal of first-strand primers. Residual first-strand primers are also tailed and can interfere with the amplification of the target DNA. Furthermore, rare populations of sequences are difficult to amplify (Uematsu, 1991). Sequence analysis of the H chain L,L,VDJ amplification product (Fig. 2B) revealed several independent clones with the expected structure (Fig. l), where the sequence corre- sponding to the 3’ end of the mRNA is fused to its former 5’ end. The H-chain V region of mAb A41 belongs to the murine subgroup II(A) (Kabat et al., 1987) which is func- tionally rearranged with a D-segment of 7 aa and segment J4 (Sakano et al., 1980). Sequencing of the L,L,VJ amplification products of the L chain revealed that two different VJ regions had been cloned (Fig. 2, C and D). One is closely homologous to the murine V region L7 (Pech et al., 1981), which is grouped with others into the miscellaneous set of murine VIC regions (Kabat et al., 1987). This V region is functionally rear- ranged with the 52 segment (Max, 1981). The other V re- gion shows close homology to the group II of murine VK regions and is rearranged to 52, however, in a nonfunc- Fig. 2. Amplification and sequence analysis of VJ and VDJ regions of mAb A41. (Panel A) Amplified DNA fragments derived from VJ and VDJ regions of mAb A41, separated on a 4% Nu SieveTM agarose gel. Lanes: a, inverse PCR amplification of the H chain V region using primers A3 and A4; b, in- verse PCR amplification of the L chain V region, using primer pair Al and A2; c,d, normal amplifications of VDJ, using primer pair C3 and C4 (two identical slots); e,f, normal amplification of VJ, using primer pair Cl and C2; m, marker fragments (DNA &f, marker VI, Boehringer Mannheim). The sequences of all primers are shown in Table I. Methods: lo6 cells of the murine hybridoma cell line A41 were mixed with 500 ~1 lysis buffer (1.272 g LiCl/3.963 g urea/66.6 ~13 M Na.acetate pH 5.2/200 ~1 10% SDS/2 ug heparin/H,O ad 10 ml) and passed several times through a narrow needle to shear chromosomal DNA. The solution was then incubated overnight to precipitate RNA. The precipitate was sedimentated by centrifugation, washed twice with 250 ~1 washing buffer (1.696 g LiCl/5.285 g urea/2 mg heparin/66.6 ~1 3 M Na.acetate pH 5.2/H,O ad 10 ml) and then dissolved in 200 ~1 300 mM Na.acetate pH 5.2/O. 1% SDS. After two extractions with phenol (equilibrated with 3% NaCl) the RNA was precipitated from the aqueous phase by adding 500 pl ethanol and incubation at 4°C overnight. For inverse PCR, 100 ng of RNA were transcribed into double-stranded cDNA by reverse transcriptase (cDNA synthesis kit, Boehringer Mannheim), precipitated with ethanol, dissolved in H,O and ligated with T4 ligase overnight at 16°C in a 40-~1 standard ligation mixture (Maniatis et al., 1982). T4 ligase was heat-inactivated subsequently and 10 ~1 of circular cDNA were included in a loo-p1 standard PCR reaction (Perkin Elmer Gene Amp TM DNA amplification kit) with primer pair Al and A2 for L chain and primer pair A3 and A4 for H chain V region amplification, Thirty temperature cycles were performed at the following conditions: 1 min at 94°C 2 min at 50°C 3 min at 72°C al- lowing 1 min for each temperature shift. For normal PCR reactions, only the first cDNA strand was synthesized and subjected to PCR amplifications as above, using primer pair Cl and C2 for L chain and C3 and C4 for H chain V regions. The DNA fragments obtained from inverse and normal PCR were restricted with the respective endonucleases. The amplified fragments were separated on 4% NuSieve agarose gels (0.5 pg/ml ethidium bromide). The DNA bands were cut out, isolated by standard techniques (Maniatis et al., 1982) and cloned into pUC BM20 or pUC BM21 (Boehringer Mannheim) for sequence determination (Sanger et al., 1977). (B) Nucleotide sequence of the H chain V region of mAb A41. Primers A3 and A4 (used for inverse PCR) are printed in bold type, as well as primers B3 and B4 were used for amplification of a fragment for insertion into an expression vector. The site where the cDNA was ligated into a circle is marked by arrows. The VDJ region of mAb A41 could also be amplified with primers C3 and C4. The CDR are underlined. Numbers above the sequence on the left indicate nt positions, the beginning of the constant region is marked by symbols; The numbers below the sequence indicate aa positions; 1 indicates the first aa of the mature sequence; upstream aa represent the signal sequence; aa l-98 represent the V region, aa 99-104 the D region and aa 105-l 18 the J region (J,4, Kabat et al., 1987). (C) Nucleotide sequence of the V region of L chain ~1 from mAb A41. Numbering of nt and aa is analogous to that described in B; the CDR are underlined. The site where the cDNA was ligated into a circle is marked by arrows. The leader sequence is not complete in this particular clone (continuation of the aa sequence is symbolized by dots). Primers Al and A2 (used for inverse PCR) as well as B 1 and B2 used for PCR (Fig. lB), are shown in bold type. The V region (aa l-96) is functionally rearranged with J,2 (aa 97-107, Kabat et al., 1987). D) Nucleotide sequence of the V region of 1c2L chain from mAb A41. Numbering of nt and aa is analogous to that in B and C; the CDR are underlined. The ligation site after cDNA synthesis is marked by arrows. Primers Al and A2 used for inverse PCR are shown in bold type. The V region is rearranged to J,2 (Kabat et al., 1987) however, in every clone sequenced a frameshift is present at the V-J junction (indi- cated by dots below the sequence). Sequences were deposited at GenBank-Los Alamos National Laboratory under accession Nos. LO2345 LO2346 and L02347.
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks