Reports

A Novel Polymorphism 3' to the Beta-Globin Gene

Description
A Novel Polymorphism 3' to the Beta-Globin Gene
Categories
Published
of 4
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  HEMOGLOBIN, 2(4), 387-390 (1998) SHORT COMMKNIC4 TION A Novel Polymorphism 3 to the P-Globin Gene C. Badens', T. Merghoub', D. Lena-Russo', D. Labie', J. Elion', and J.F. Matte? Luboratoire des Hdmoglobines CERGM Faculte de Mddicine de la Timone 3385 Marseille Cedex 5, France NSERM U458 dpilal R. Debrd 75 19 Paris France CGM CHU Cochin-Port-Royal Paris France The Dnase I hypersensitive site located 3' to the P-globin gene (3'HSl) has been previously cloned and characterized (1). This region shows potentially important structural features, including SARs, topoisomerase I1 recognition sites, several GATA-1 binding sites, and an NF-E2 recognition sequence clustered around the Dnase I sie. In addition, the region located near the Dnase I sites is very A-T rich (around 80%). Polymerase chain reaction (PCR) amplification and sequencing were used to detect polymorphisms in the A-T rich region of the 3'HS 1. The segment explored extends over 1050 bp. Some 51 samples were tested that can be classified as follows: 22 were homozy- gous for the sickle cell mutation ps) 13 Africans eight North--cans, and one Indian), seven were Ps-P-thalassemia (thal) (sixNorth-Africans and one African), 18 were PA@ , and four P-thal/P-thal all of Mediterranean srcins). PCR Conditions andProducts Analjsis DNA sequencing ofthe amplified fragments was used in the five samples initially studied. Polymorphisms were later determined by gel electrophoresis of PCR products on an ALF sequencer (Pharmacia). PCR employed 100 ng of genomic DNA, 200 mM dNTP, 30 pm of unlabeled primer, and 3 pm of primer labeled with fluorescein, The primer sequences used for the PCR were as follows: 5'-TCCATAGGC TGACTGAGAGTGTAGAGGAGG-3' from nucleotide (nt) 1401 o 143 l), 5' fluo TACCAC AAACCTGUGTAGGCTTAAATT-3' (from nucleotide 2453 to 2425). The 1053 bp fragments were restricted by NsiI and the resulting fluorescein-labeled fragments, 240 bp in 3 87 Copyright 998 by Marcel Dekker, Inc. www.dekkcr.com    H  e  m  o  g   l  o   b   i  n   D  o  w  n   l  o  a   d  e   d   f  r  o  m   i  n   f  o  r  m  a   h  e  a   l   t   h  c  a  r  e .  c  o  m   b  y   I   N   S   E   R   M    T  e  s   t   I   D  o  n   0   1   /   0   4   /   1   4   F  o  r  p  e  r  s  o  n  a   l  u  s  e  o  n   l  y .  388 a b. BADENS ET AL. Figure 1 Detection of the two alleles by means of the variation in length. Electrophoresis ofthe 240 bp fluorescein-labeled PCR fragments is performed on an automated sequencer. The first peak on the left is the fluorescent primer, the second is the 240 bp fragment. Lane a: a sample homozygous for the insertion; lane b: a sample heterozygous for the insertion. AAATTGCTAAAAAATAAATATTTTATGTTCTCACCACAA TTGGAAGGTGATTCATATGCTAATTAGCTAGATAGACTCTCTCTA CAATGTATATATAGATCAAACATCACATTGTATCCCATAACATAT TATATATATTATATATTTATATTATATATTATTATTGTATCCATT AATATAT(+G)CACTTATAITAT IT(+G)CCAGGCAA~TAAAAAA TGTT TA4AATATAAATTTA 'TGTAACCTCCTT'TTACT CT STTGGTTTTCTTCTTTCATTCAGTGTTTACCAGTTTCTTATAGT TAATTTTATTTTAAGCTGTCTC CATTTTCTGAAGAAhWGGAAC ATATTAAA~CAACAAAACAAATACACTATCTTGCATGAGATGAT TTATGTCATGGTACAATCAAATGCTATAAATCTTATTATAAMACTTC TCAAATGGTTAGATGGCTACAGTTGAACAGATGGACCATGTCATA TA~ATAATGCTTCTAAGGTATGGCTAA~~TA AGTAATGATGGGAATATTATTTATAGAAATCTTATAAAATA TATAATGAAATATGTAATAAAGTCT~GAT~TGTGTATATACAT AATATATATTTATTACATAATATATAATATATAATG~ATATTTAT ATATTACATGCATTATATATTAAATAT~TACATT TTATATATTA TATATTM.AATATGTAAT(AAT) TGTTATTAAATATATACAATA ATCTATTACATTTTATGCTTATATAATATATAAT~TATATAGT ATATAATAAATATACACTATATATTTGTATCTATATATGTTTATA 45 90 135 180 225 27 315 360 405 450 495 540 585 630 675 720 765 810 855 Figure 2 Sequence of genomic DNA containing 3'HSl. The GATA-1 and topoisomerase consensus sites are underlined. The AAT insertion (nt 738) and the differences with the previously published sequence (nt 187 to 204) are in boId type.    H  e  m  o  g   l  o   b   i  n   D  o  w  n   l  o  a   d  e   d   f  r  o  m   i  n   f  o  r  m  a   h  e  a   l   t   h  c  a  r  e .  c  o  m   b  y   I   N   S   E   R   M    T  e  s   t   I   D  o  n   0   1   /   0   4   /   1   4   F  o  r  p  e  r  s  o  n  a   l  u  s  e  o  n   l  y .  A NOVEL POLYMORPHISM 389 length, were analyzed by electrophoresis. Because of the high A-T richness of the region, no suitable primers can be found to amplify in one shot the 240 pbp fragment. Polymorphism Out of the 102 chromosomes tested, 53 presented an insertion of an AAT trinucleotide when compared to the published sequence (Figs. 1 and 2). This AAT insertion immediately follows another AAT trinucleotide. Noticeably, among the 51 Ps chromosomes, this insertion has always been found linked to the Benin haplotype (2) (32 chromosomes) or to the Indian haplotype (3) (2 chro- mosomes). Other Ps haplotypes were Bantu (4) (12 chromosomes) and Senegal (4) (5 chromosomes). Concerning the other chromosomes, five of the 5 P-thal and 14 of the 36 PA presented the insertion (haplotypes were not determined). Co-dominant Mendelian inheritance was observed in two two-generation families. The AAT insertion lies in the most A-T rich region of the 3'HSl (88% from nt 495 to nt 855 in Fig. 2). Numerous polyd(A-T) are present which have previously been involved in stable base-unpairing 5). This AAT polymorphism does not alter any of the GATAs sites nor the topoisomerase's sites, but it could amplify the potential unwinding of the region. Comments DNA sequence analysis of the concerned fragment revealed three differences with the previously published 3 HSl sequence (1). From nt 187 to 204: AT(+@ CACTTAT T/A ATTT(+G)CC (Fig. 2). Acknowledgements C.B. was the recipient of a fellowship ?om the Assistance Publique de Marseille, France. REFERENCES 1. 2. 3. 4. Fleenor, D.E. and Kaufman, R.E.: Characterization ofthe Dnase I hypersensitive site 3' ofthe human P-globin gene domain. Blood, 81:2781-2790, 1993. Pagnier, J., Mears, J.G., Dunda-Belkhodja, O., Schaefer-Rego, K.E., Beldjord, C., Nagel, R.L., and Labie, D.: Evidence for the multicentric srcin of the sickle cell hemoglobin gene in Africa. Proc. Natl. Acad. Sci. USA, 80:1771-1773, 1984. Kulozik, A.E., Wainscoat, J.S., Sejeant, G.r., Kar, B.C., Al-Awamy, B., Essan, G.J.F., Falusi, A.G., Haque, S.K., Hilali, A.M., Kate, S., Ranasinghe, W. A.E.P., and Weatherall, D.J.: Geographical survey of Ps globin gene haplotypes: evidence for an independent Asian origin of the sickle cell mutation. Am. J. Hum. Genet., 39:239- 244,1986. Chebloune, Y., Pagnier, J., Trabuchet, G., Faure, C., Verdier, G., Labie, D., and Nigon, V.: Structural analysis of the 5 flanking region of the P-globin gene in Afiican    H  e  m  o  g   l  o   b   i  n   D  o  w  n   l  o  a   d  e   d   f  r  o  m   i  n   f  o  r  m  a   h  e  a   l   t   h  c  a  r  e .  c  o  m   b  y   I   N   S   E   R   M    T  e  s   t   I   D  o  n   0   1   /   0   4   /   1   4   F  o  r  p  e  r  s  o  n  a   l  u  s  e  o  n   l  y .  39 BADENS ET AL. sickle cell anemia patient: hrther evidence for three srcins of the sickle cell mutation in Africa. Proc. Natl. Acad. Sci. USA, 5:4431-4435, 1988. Bode, J., Kohwi, Y., Dickinson, L., Joh, T., Khler, D., Mielke, C., and Kohwi-Shige- matsu, T.: Biological significance of unwinding capability of nuclear-associating DNAs. Science, 255:195-197, 1992. 5. Received: March 27, 1998 Accepted: May 5, 1998    H  e  m  o  g   l  o   b   i  n   D  o  w  n   l  o  a   d  e   d   f  r  o  m   i  n   f  o  r  m  a   h  e  a   l   t   h  c  a  r  e .  c  o  m   b  y   I   N   S   E   R   M    T  e  s   t   I   D  o  n   0   1   /   0   4   /   1   4   F  o  r  p  e  r  s  o  n  a   l  u  s  e  o  n   l  y .
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks