Graphic Art

A truncating mutation in theIL1RAPL1 gene is responsible for X-linked mental retardation in the MRX21 family

Description
A truncating mutation in theIL1RAPL1 gene is responsible for X-linked mental retardation in the MRX21 family
Categories
Published
of 6
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
    2006 Wiley-Liss, Inc. American Journal of Medical Genetics 140A:482–487 (2006)  A Truncating Mutation in the  IL1RAPL1  Gene IsResponsible for X-linked Mental Retardation in the MRX21 Family  Elisabetta Tabolacci, M. Grazia Pomponi, Roberta Pietrobono, Alessandra Terracciano,Pietro Chiurazzi, and Giovanni Neri* Istituto di Genetica Medica, Universita` Cattolica, Roma, Italy  Received 22 November 2005; Accepted 7 December 2005  X-linked mental retardation (XLMR) is a genetically hetero-geneous condition, due to mutations in at least 50 genes,involved in functioning of the central nervous system andlocated on the X chromosome. Nonspecific XLMR (MRX) ischaracterized essentially by mental retardation transmittedby X-linked inheritance. More than 80 extended MRX pedigrees have been reported to date, which have beendistinguished exclusively by physical position of thecorresponding gene on the X chromosome, established by linkage analysis. One such family, MRX21, which wasdescribed by us in 1993 and localized to Xp11.4-pter, hasnow been reanalyzed with additional markers and after onemore affected individual had became available. This extrainformation allowed a significant reduction of the linkageinterval and, eventually, identification of the mutant gene. A stop mutationin exon 10 ofthe  IL1RAPL1 gene (in Xp21)wasfound in the four affected males and in obligate carriers,allowing conclusive counseling of other family members of uncertain carrier status. The W487X mutation results in theproduction of a truncated IL1RAPL protein, comprised of theextracellular Ig-like domain and transmembrane tract, butlacking the last 210 aminoacids of the cytoplasmic domain.MRX21 is the first extended MRX family with a pointmutation in  IL1RAPL1  and the second with a stop mutation, which had been previously found only in a small family. Ourreport confirms the role of the  IL1RAPL1  gene in causingnonspecific mental retardation in males and underlines theimportance of detailed linkage analysis before candidategene mutational screening.   2006 Wiley-Liss, Inc. Key words:  X-linked mental retardation; MRX21; linkageanalysis;  IL1RAPL1  gene; stop mutation INTRODUCTION  X-linked mental retardation (XLMR) is a clinically  variable and genetically heterogeneous condition,due to mutations in more than 50 genes on the X chromosome [Chiurazzi et al., 2004; Kleefstra andHamel,2005].Anupdatedlistoftheseconditionscanbe found in the XLMR Update Web site (http://xlmr.interfree.it/home.htm) and in the dedicatedpage at Greenwood Genetic Center (http://www.ggc.org/xlmr.htm). Some XLMR conditions, such asthe fragile X syndrome, are clinically recognizableand are considered specific (MRXS). On the otherhand,inmanyfamiliestheonlymanifestationsharedby patients is mental retardation. Such MRX pedi-grees are sometimes sufficiently large to allowlinkage analysis yielding a significant LOD score that willpositiontheresponsiblegeneinagivenlocationon the X chromosome. More than 80 MRX familieshavebeenreportedandmutationsinatleast21XLMR geneshavebeenfoundin24ofthosefamilies(http://xlmr.interfree.it/home.htm). Therefore, at least 50MRX pedigrees are still in search of a gene. TheMRX21 pedigree (Fig. 1) was reported by us in 1993[Kozak et al., 1993]. Linkage analysis had positionedthe responsible gene in a large interval between the Xp telomere and marker DXS7 (Xp11.4). This 43Mbaseintervalcontainedtoomanygenestoallowanefficientmutationalscreeningatrandom.Recently,aDNA sample from patient III-1 became available,prompting us to reanalyze this pedigree withmarkers distributed in the previously defined Xpter-p11.4 critical region. Our attempt relied alsoon the employment of 31 new DNA markers thatfacilitated the definition of a much smaller linked Grant sponsor: Fondazione Telethon Onlus; Grant number:GGP030202; Grant sponsor: Conquer Fragile X Foundation; Grantnumber: 2004.*Correspondence to: Giovanni Neri, M.D., Istituto di Genetica Medica,Universita` Cattolica, Largo F. Vito 1, 00168 Rome, Italy.E-mail: gneri@rm.unicatt.itDOI 10.1002/ajmg.a.31107  region of 13.2 Mbases. This region contained fourknownXLMRgenes(  ARX  ,  IL1RAPL1 , GK  ,and  DMD  )andwescreenedformutationsin  ARX  and  IL1RAPL1 . A stop mutation was found in exon 10 of   IL1RAPL1 .This mutation (W487X) causes the production of atruncated protein, lacking 210 aminoacids of itscytoplasmicdomain.ThisisthefirstlargeMRXfamily in which a point mutation in the  IL1RAPL1 gene wasfound, while the first point mutation (Y459X) hadbeen reported by Carrie et al. [1999] in a smallpedigree with three affected brothers. MATERIALS AND METHODSFamily Tree and Linkage Analysis The MRX21 pedigree had been originally describedbyKozaketal.[1993],buttheDNAsampleofpatientIII-1wasunavailable.Threemorepotentialcarriers have also been included in the present study (III-3, III-6, and III-8). The MRX numbers areassigned to families with nonspecific X-linkedmental retardation with a LOD score above 2 by theHUGO Gene Nomenclature Committee (http:// www.gene.ucl.ac.uk/nomenclature/).The 31 microsatellite markers employed in thisstudy, spanning the short arm of the X chromosome,are listed in Table I. Primers were retrieved from theEnsEMBL database (http://www.ensembl.org) andare available on request. Genomic DNA (50 ng) wasaddedtoPCRreactionsinafinalvolumeof20 m lwithPromega Master Mix, 0.8  m l of each primer (10  m M)and 0.1  m l of   32 P- a dCTP. PCR conditions were: 1 0 denaturation at 95 8 , 1 0 annealing at 52 8  –58 8  and 1 0 extension at 72 8  for 30 cycles. Alleles were detectedby autoradiography after resolution on denaturingpolyacrylamide gel electrophoresis. Two-point link-age analysis between the disease locus and the various markers was performed with the LIPEDprogram (version April, 1993) by Ju¨rg Ott, assumingequal allelic frequencies for the markers and afrequency of 1  10  4 for the mutant allele at thedisease locus. Mutational Screening of Candidate Genes The various exons of the  ARX   and  IL1RAPL1  gene were first amplified by PCR from genomic DNA,treated with hexonuclease and phosphatase,sequenced with Big Dye Terminator cycle sequen- F IG . 1.  PedigreeoftheMRX21familyandhaplotypereconstructionwithinthenewlyidentifiedcriticalregion.Theboxedhaplotypeissharedbyallfourpatientsandobligate carriers, the minimal overlap being between markers DXS8027 (Xp22.11) and DXS1110 (Xp21.1). Female carriers of the c.1460G >  A mutation have a blacksmall circle in their symbol and two of them (I-1 and II-1) are shaded in gray to indicate that they have learning disability. TRUNCATING MUTATION IN THE  IL1RAPL1  GENE  483  American Journal of Medical Genetics: DOI 10.1002/ajmg.a   cing kit v.3.1 (Applied Biosystems, Foster City, CA)and then run on an ABI Prism 3100 (AppliedBiosystems) for detection.The following primers were designed by us for thefour exons of the  ARX   gene: ex1F—TCC CAC CCTCCG GGA GAG; ex1R—CAA ATT GAC AAT TCC AGGCCAC;ex2AF—CAAGGCGTCGAAGTCTGGTG; ex2AR—GTA CGA CTT GCT GCG GCT GA;ex2BF—CTCCTTCAGGGTGCGGCAGC;ex2BR— CCAGCAGCTCCTCCTCGTCG;ex2CF—CGTCACGCA CCC GGA GGA GC; ex2CR—AGC CCG CTGTCC CTC CCT GG; ex3F—AAT AGC TGA GAG GGC ATT GCT; ex3R—GAG AGT GCT TGG GTC TACTTT; ex4AF—GCC AAG GGA AGG GAC GGG TA;ex4AR—GGT AGG GGC TGA GCG GGT GG;ex4BF—GAG AAG GCA GGC GCG CAG AC;ex4BR—ACT CCT GCC TCC TCC CTG CC; ex5F— TAA GCG AAA CCA CCG AAT CC; ex5R—TGG TCCTCT GTT TCC ATT TGG.The following primers were designed by us for the10 exons of the  IL1RAPL1  gene: ex1F—ATT GCA CCG ATC ATG TTT GA; ex1R—TGT GCT CCA CCT ATTTACTCATAAT;ex2F—TTTTTGCCTCTAATGTTT TTC CT; ex2R—GCA ACA TTT AAG TAC GAG AAA GCA; ex3F—GAA CCC TGT GGA ATA AGTCAA GAT; ex3R—ATC CAA TTT GTC CCA GAA TAT AAG G; ex4F—GCA AAT TGA TTC CCC AGA GA;ex4R—TTG CAA GTG AAA TAT TGA AGA CTG;ex5F—CGT TAC TTG GTA GAG CAC TTT AAC A;ex5R—TTAGCTGCGAGTATTACATCGG;ex6F—  AAG TGA TCA AAA TGT TAC CTG TCA G; ex6R—  ATT CAT GTT TTG CAA TTC CAT AGT A; ex7F—  AAC ACA GCA TCA ATT CAT AGC C; ex7R—TTT AGG AGA ACT TTG TGG AGA AAA A; ex8F—CTC ATGCAAAAAGGA AAGGG;ex8R—AATATACGA GCTGCTGCCATT;ex9F—ACATTTGGAGACGTTTATGAAAAA;ex9R—GAATATGCACACTCTCAA  ATGAAAA;ex10AF—CCGGGAAAAAAAAATATTGCT; ex10AR—GCC ATT TAA TGA CCG TCA GG;ex10BF—ATG CTT GTG ACT GGA GAA ATT AAA;ex10BR—ACG TCG TAC TCA TAG CTT CGG;ex10CF—TGT CTC GGC CAT TTC CAT G;ex10CR—GGA TTT AGT TCC AGG CAC TGG.  X-Inactivation Assay  The androgen receptor X-inactivation test wasessentially performed as described by Allen et al.[1992], adapted with fluorescent AR primers. Briefly,an aliquot of 500 ng of genomic DNA was digestedovernight at 37 8 C with 10 units methylation sensitiveenzymes HpaII and HhaI in 20  m l. After digestioncontrol on an agarose gel, 1–3  m l of the digestedDNA, as well as 50 ng of undigested DNA from thecorresponding sample, were amplified by PCR  with fluorescent primers flanking the CAG repeat inexon 1 of the  AR   gene (AR-F: GCT GTG AAG GTTGCT GTT CCT C; AR-R: AGA GGC CGC GAG CGC AGC ACC TC). An aliquot (2–4  m l) of the PCR reaction was mixed with 14.5  m l deionized forma-mideand0.5 m lofROXmarkers,beforebeingloadedon the ABI 310 sequencer for resolution anddetection. The active proportion of the maternally inherited chromosome was determined by the ratioPA  mat ¼ p/(p þ m), where p and m are the areas of the peaks corresponding to the paternal andmaternal AR alleles. RESULTS In the srcinal report of the MRX21 family [Kozaket al., 1993], the linkage study had been limited TABLE I. List of the 31 Markers Spanning the Short Arm of the X Chromosome Until DXS7Marker/gene Mbases from Xp Cytogenetic bandDXS1071 1.71 Xp22.33DXS1060 5.27 Xp22.32 NLGN4   5.60–6.00 Xp22.32-.31DXS996 5.72 Xp22.32DXS1223 8.3 Xp22.31DXS8051 9.31 Xp22.31-p22.2DXS7108 10 Xp22.2  MID1  10.22–10.40 Xp22.2 PRPS2   12.56–12.60 Xp22.2DXS1224 12.99 Xp22.2 OFD1  13.51–13.55 Xp22.2DXS987 14.47 Xp22.2 NHS   17.14–17.51 Xp22.2-22.13DXS8019 17.5 Xp22.13 CDKL5   /  STK9   18.20–18.42 Xp22.13DXS7161/DXS7163 18.81 Xp22.13 PDHA1  19.12–19.14 Xp22.12 RPS6KA3   /  RSK2   19.93–20.04 Xp22.12 SMS   21.72–21.77 Xp22.11DXS1683 22.02 Xp22.11DXS7593 22.15 Xp22.11DXS1226 22.7 Xp22.11DXS451 23.05 Xp22.11DXS989 22.94 Xp22.11DXS8027 24.29 Xp22.11  ARX   24.78–24.80 Xp22.11DXS8058 25.05 Xp21.3DXS1061 27.2 Xp21.3 IL1RAPL1  28.36–29.73 Xp21.2DXS992 30.05 Xp21.2DXS985 30.34 Xp21.2 GK   30.43–30.51 Xp21.2DXS1214 31.02 Xp21.2DXS1036 31.53 Xp21.1DXS997 31.64 Xp21.1DXS1219 31.84 Xp21.1 DMD   30.89–33.00 Xp21.2-p21.1DXS538 34.07 Xp21.1DXS1110 37.45 Xp21.1-p11.4 OTC   37.97–38.03 Xp11.4 TM4SF2   38.18–38.30 Xp11.4DXS1068 38.66 Xp11.4DXS8102 38.84 Xp11.4DXS8015 39.54 Xp11.4DXS993 40.9 Xp11.4DXS7 43.2 Xp11.3 The known XLMR genesare indicated inbold and theinterval shaded in grayisthe new critical region between recombinant markers DXS8027 and DXS1110. 484  TABOLACCI ET AL.  American Journal of Medical Genetics: DOI 10.1002/ajmg.a   to patients II-5, III-2, and III-5, positioning theresponsible gene between Xp11.4 and the Xptelomere. Recently, a DNA sample from patient III-1becameavailableandweperformedanewlinkageanalysis with a total of 31 markers spanning the43-Mbase critical region (Table I). The relevantportion of the reconstructed haplotypes is indicatedin Figure 1, showing that the proximal recombinantmarker is no longer DXS7 (Xp11.3), but the moretelomeric DXS1110 (Xp21.1), which is recombinantinobligatecarrierII-3andherchildrenIII-5andIII-6.Most importantly, patient III-1 appears to be recom-binant at marker DXS8027 (Xp22.11), reducing thecritical region to just 13 Mbases between DXS8027and DXS1110. Markers DXS1214 and DXS538 arelinked to the disease with a two-point LOD score of 2.408 and 2.114, respectively. The newly definedcritical region includes four known XLMR genes,namely   ARX  ,  IL1RAPL1 ,  GK  , and  DMD  . We thenproceededtomutationalscreeningof   ARX  andfoundno mutations. The next sequenced gene,  IL1RAPL1 ,has 10 exons and it was in this last exon that weidentified the c.1460G >  A (NM_014271) transition which creates a stop codon (TAG) in position 487 of the 696-aminoacid protein.This mutation was confirmed in all four patientsand, in heterozygous state, in obligate carriers (II-1,II-2, and II-3) and in one female (III-6) whose carrierstatus was uncertain. The other at-risk females of thefamily (II-4, III-3, and III-8) were found not to carry the mutation. The carrier status of II-4 was particu-larly uncertain, as she carried the disease-associatedhaplotype up to marker 1214 in Xp21.2 (Fig. 1). Thefinding that  IL1RAPL1  lies between DXS1214 andDXS8027, telomeric to the small interval shared by her and the affected males in the family (Fig. 1) alsoconfirms that she is not a carrier. Heterozygouscarriers of mutations in the  IL1RAPL1  gene werereported not to show any degree of mental impair-ment. Therefore we were surprised by the observa-tion that two obligate carriers in MRX21 (I-1 and herdaughter II-1) have learning disability. In order todetermineiftheX-inactivationstatusinthesefemalescorrelates with their IQ level, we employed theandrogen receptor X-inactivation assay [Allen et al.,1992]. We did find a significant skewed X-inactiva-tion in obligate carriers ( > 80:20). However, whilecarrier II-1, with learning disability, has the paternal(wild-type)alleleactivein78%ofhercells,hercarriersister II-2 has a similarly skewed ratio (85% activepaternal allele) but a normal IQ (data not shown).Furthermore, carrier II-3 has the maternal (mutant)allele active in 98% of her blood leukocytes and anormal IQ (data not shown). DISCUSSION  X-linked mental retardation is often subdivided inspecific (MRXS) and nonspecific (MRX) forms forpractical reasons, depending on the presence orabsence of characteristic signs or clinical manifesta-tionsotherthanmentalretardation.Thisdistinctionissometimes difficult to make, because some  XLMR  genes can be involved in both specific and non-specific forms [Chiurazzi et al., 2004; Kleefstra andHamel, 2005]. Pedigrees with nonspecific XLMR,such as MRX21, can be distinguished only by theirlinkage mapping until a mutation is found in acandidate gene. Over 80 MRX families have beenreported until now, all positionally mapped by linkage with a significant two-point LOD score( > 2.0). When the linkage interval is too large,mutational screening of many XLMR genes is notpractical with the presently available techniques(sequencing, preceded by SSCP or DHPLC),although it might become feasible with the employ-ment of DNA sequencing microarrays in the future.Thisexplainswhyatleast50MRXfamiliesaresimply mapped on some interval of the X chromosome, with mutant genes still unidentified (http://xlmr.interfree.it/home.htm). An opportunityto find the gene mutated in MRX21presented when we received a DNA sample frompatient III-1, who had been previously unavailable.Inordertoreducethecriticalregion,weexamined31new microsatellite markers spanning almost theentire short arm of the X chromosome (Table I).Patient III-1 turned out to be recombinant at locusDXS8027(Xp22.11),thuseliminating24Mbasesfromthe linkage interval (Fig. 1). Furthermore, re-evalua-tion with new markers of the previous distal(centromeric) breakpoint allowed the reduction of   5 Mbases between former recombinant markerDXS7 (Xp11.3) and DXS1110 (Xp21.1). In the newcritical region of 13.2 Mbases (Table I) there were4 known XLMR genes. We started the mutationalscreeningfromthe  ARX  gene,whichwasnormal.Wethen proceeded to screen  IL1RAPL1  until we founda stop mutation (c.1460G >  A; W487X) in exon 10.It is worth remembering that only the iden-tification of the causative mutation allowed us todetermine the status of individual II-4, who shareda portion of the minimal critical region definedby linkage analysis and could not be counseledappropriately.The  IL1RAPL1  gene (OMIM *300206) was identi-fied as an  XLMR   gene in 1999 by Carrie et al. [1999], who associated its deletion or mutation to nonspe-cificmentalretardation.However,  IL1RAPL1 appearsto be often involved in larger deletions including theneighboring  DAX1 , GK  ,and possibly   DMD  genes.Inthis case patients may present with congenitaladrenal hypoplasia [Muroya et al., 1999; Sasakiet al., 2003; Choi et al., 2005], glycerol kinasedeficiency [Zhang et al., 2004] and Becker musculardystrophy [Love et al., 1990; Jin et al., 2000]. Isolatedmicrodeletions of the region harboring  IL1RAPL1  were reported even before the identification of  TRUNCATING MUTATION IN THE  IL1RAPL1  GENE  485  American Journal of Medical Genetics: DOI 10.1002/ajmg.a   the gene [Billuart et al., 1996; des Portes et al., 1998].One such microdeletion removed the DXS1218microsatellite marker in intron 1 of the  IL1RAPL1 gene in a large family described as MRX34[Raeymaekers et al., 1996], which was instrumentalin cloning the gene [Carrie et al., 1999]. Thisgenomic region must be particularly prone to non-homologous recombination, because pericentricinversions have also been characterized that inter-rupt the  IL1RAPL1  gene, causing mental retardationin a male [Lepretre et al., 2003] and possibly inthe female patient reported by Laumonnier et al.[2002].The  IL1RAPL1  gene spans approximately 1.3Mbases of genomic DNA, is composed of 10 exonsand has a cDNA of 3.6 kbases (NM_014271) with anopen reading frame encoding a protein of 696aminoacids (NP_055086). The protein structureincludes three extracellular immunoglobulin-likedomains (   330aa), a short transmembrane tract(19aa), a TIR (Toll/IL1R-related) domain specific tothe IL1R superfamily (164aa) and finally a specific125aa C-terminal domain [Born et al., 2000; Khanetal.,2004].Thiscarboxy-terminaldomainisspecificfor  IL1RAPL1 and its homolog  IL1RAPL2  , which wasidentifiedinXq22[Born etal.,2000;Sanaetal.,2000;Ferrante et al., 2001]. This latter domain was recently found to mediate the interaction of   IL1RAPL1  withthe neuronalcalcium sensor-1protein,which inturnregulates exocytosis [Bahi et al., 2003]. MRX21 is theonly large family with a point mutation of the  IL1RAPL1  gene reported so far. Interestingly,the W487X mutation causes the production of atruncated protein lacking half of the intracellular TIR domain and the entire C-terminal domain, just liketheonlyotherpointmutation(Y459X)describedinasmall family by Carrie et al. [1999].Finally, X-inactivation was skewed ( > 80:20) in thethreeobligatecarriersoftheMRX21pedigree,aswassuggestedbyPlengeetal.[2002].However,whenwedetermined the origin of the mostly active X chromosome, we found that carriers II-1 and II-2had both 80%–85% of cells with the paternal(normal) allele on the active X chromosome,although they were discordant for IQ level. Further-more, carrier II-3 had almost 99% of blood cells withthe maternal (mutant) allele on the active X, yet herIQ is normal. We conclude that there is probably asignificant difference in X-inactivation betweenblood leukocytes and brain neurons, accountingfor the discrepancy in mental status of heterozygotecarriers in the MRX21 family. Our observations alsochallenge the notion that heterozygous carriers of   IL1RAPL1  mutations are always of normal intelli-gence, srcinally proposed by Carrie et al. [1999]. Actually, disruption of the  IL1RAPL1  gene may wellexplain why the female carrier of a pericentricinversion described by Laumonnier et al. [2002] hadmild mental retardation.  ACKNOWLEDGMENTS The authors acknowledge the financial support of Fondazione Telethon Onlus (grant GGP030202 toG.N.)andConquerFragileXFoundation(grant2004to G.N.). REFERENCES  Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW.1992. Methylation of HpaII and HhaI sites near the poly-morphic CAG repeat in the human androgen-receptor genecorrelates with X chromosome inactivation. Am J Hum Genet51:1229–1239.Bahi N, Friocourt G, Carrie A, Graham ME, Weiss JL, Chafey P,Fauchereau F, Burgoyne RD, Chelly J. 2003. IL1 receptoraccessory protein like, a protein involved in X-linkedmental retardation, interacts with Neuronal CalciumSensor-1 and regulates exocytosis. Hum Mol Genet12:1415–1425.Billuart P, Vinet MC, des Portes V, Llense S, Richard L, MoutardML, Recan D, Bruls T, Bienvenu T, Kahn A, Beldjord C, Chelly  J.1996.IdentificationbySTSPCRscreeningofamicrodeletionin Xp21.3-22.1 associated with non-specific mental retarda-tion. Hum Mol Genet 5:977–979.Born TL, Smith DE, Garka KE, Renshaw BR, Bertles JS, Sims JE.2000. Identification and characterization of two members of anovel class of the interleukin-1 receptor (IL-1R) family.Delineation of a new class of IL-1R-related proteins basedon signaling. J Biol Chem 275:29946–29954.Carrie A, Jun L, Bienvenu T, Vinet MC, McDonell N, Couvert P,Zemni R, Cardona A, Van Buggenhout G, Frints S, Hamel B,MoraineC,RopersHH,StromT,HowellGR,WhittakerA,RossMT,KahnA,FrynsJP,BeldjordC,MarynenP,ChellyJ.1999.A new member of the IL-1 receptor family highly expressed inhippocampus and involved in X-linked mental retardation.Nat Genet 23:25–31.Chiurazzi P, Tabolacci E, Neri G. 2004. X-linked mentalretardation (XLMR): From clinical conditions to cloned genes.Crit Rev Clin Lab Sci 41:117–158.ChoiJH,ShinYL,KimGH,KimY,ParkS,ParkJY,OhC,YooHW.2005. Identification of novel mutations of the DAX-1 gene inpatients with X-linked adrenal hypoplasia congenita. HormRes 63:200–205.des Portes V, Carrie A, Billuart P, Kieffer V, Bienvenu T, Vinet MC, Beldjord C, Kahn A, Ponsot G, Chelly J, MoutardML. 1998. Inherited microdeletion in Xp21.3-22.1 in- volved in non-specific mental retardation. Clin Genet 53:136–141.FerranteMI,GhianiM,BulfoneA,FrancoB.2001.IL1RAPL2mapsto Xq22 and is specifically expressed in the central nervoussystem. Gene 275:217–221. JinH,GardnerRJ, ViswesvaraiahR, MuntoniF,Roberts RG.2000.Twonovelmembersoftheinterleukin-1receptorgenefamily,one deleted in Xp22.1–Xp21.3 mental retardation. Eur J HumGenet 8:87–94.Khan JA, Brint EK, O’Neill LA, Tong L. 2004. Crystal structure of the Toll/interleukin-1 receptor domain of human IL-1RAPL. J Biol Chem 279:31664–31670.KleefstraT,HamelBC.2005.X-linkedmentalretardation:Furtherlumping, splitting and emerging phenotypes. Clin Genet67:451–467.Kozak L, Chiurazzi P, Genuardi M, Pomponi MG, Zollino M, NeriG. 1993. Mapping of a gene for non-specific X linked mentalretardation: Evidence for linkage to chromosomal region Xp21.1–Xp22.3. J Med Genet 30:866–869.Laumonnier F, Ronce N, Hamel BCJ, Thomas P, Lespinasse J,Raynaud M, Paringaux C, van Bokhoven H, Kalscheuer V,Fryns JP, Chelly J, Moraine C, Briault S. 2002. Transcriptionfactor SOX3 is involved in X-linked mental retardation with 486  TABOLACCI ET AL.  American Journal of Medical Genetics: DOI 10.1002/ajmg.a 
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks