Marketing

A variation in the structure of the protein-coding region of the human p53 gene

Description
A variation in the structure of the protein-coding region of the human p53 gene
Categories
Published
of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Gene, 70 (1988) 245-252 Elsevier GEN 02423 245 zyxwvutsr A variation in the structure of the protein-coding region of the human ~53 gene (Recombinant DNA; malignant tissue; RFLP; promoter; enhancer; intron; exon; phosphoprotein; cell division) V.L. Buchman, P.M. Chumakov, N.N. Niukina, O.P. Samarina and G.P. Georgiev Institute of Molecular Biology, U.S.S.R. Academy of Sciences, Moscow B-334 U.S.S.R.) Received 20 January 1988 Accepted 28 January 1988 Received by publisher 7 April 1988 SUMMARY An extensive analysis of genomic DNA preparations from a number of normal and malignant tissues revealed BgZII site polymorphism of the human ~53 gene. Approximately 10 of p53 gene alleles were found to contain an additional BgZII site localized in a region of intron I. This allelic form of p.53 gene was also responsible for ~53 protein having altered electrophoretic mobility. Molecular cloning and sequencing of both the alleles of p53 gene revealed a base-pair change in codon 72 causing arginine + proline substitution in the allele with the additional BgZII site. Both variants of the ~53 gene may occur in homozygous state and are therefore functional. INTRODUCTION Mammalian phosphoprotein ~53 was shown to play an essential role in the regulation of cell division as it is required for the transition from phase G, to G, of the cell cycle (Milner and Milner, 198 1; Mercer et al., 1982; 1984; Reich and Levine, 1984). The level of this protein is very low in normal cells due to its Correspondence to: Dr. P. Chumakov, Institute of Molecular Biology, U.S.S.R. Academy of Sciences, Vavilov Street 32, Moscow B-334 (U.S.S.R.). Abbreviations: aa, amino acid(s); bp, base pair(s); kb, kilobases or 1000 bp; nt, nucleotide(s); ~53, transformation-related pro- tein; ~53, gene coding for ~53; PBS, phosphate-buffered saline (0.14 M NaCl-0.01 M sodium phosphate, pH 7.2); RIPA, see MATERIALS AND METHODS, section zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA ; SDS, sodium dodecyl sulfate; SSC, 0.15 M NaCl-0.015 M zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDC a . citrate, pH 7.3. short life time (Oren et al., 1981). In contrast, a number of cell lines transformed by a wide variety of agents have been found to express high levels of p53 (Crawford et al., 1981; DeLeo et al., 1979; Lane and Crawford, 1979; Linzer and Levine, 1979; Rotter et al., 1981). Now there are direct evidences that phosphoprotein ~53 may contribute to transfor- mation and malignancy. It was shown that primary rodent cells can be transformed by cotransfection of the cells with activated human c-Ha-vus gene and p53-expressing constructs (Eliyahu et al., 1984; Parada et al., 1984; Jenkins et al., 1984). When linked to a strong promoter-enhancer, a mouse ~53 cDNA can immortalize primary cells in culture (Jenkins et al., 1984). Transfection of established fibroblasts with p53-expressing plasmids renders the cells tumsrcenic in nude mice (Eliyahu et al., 1985; Kelekar and Cole, 1986). Moreover, introduction of a functional ~53 gene into Abelson murine leukemia 0378-I 119/X8/ 03.50 0 1988 Elsevier Science Publishers B.V. (Biomedical Division)  246 virus-transformed cells that lack p53 causes the for- mation of lethal tumors in the hosts (Wolf et al., 1984; Wolf and Rotter, 1984). These data suggest that ~53 belongs to the nuclear oncoprotein family and may act similarly to the products of Ela, myc and fos genes. The m~hanisms of p53 gene activation in trans- formed cells are not known. The above-mentioned examples of p53-directed experimental transfor- mations indicate that a normal p53-coding region may cause cell growth alterations when linked to heterologous regulatory signals. On the other hand, introduction of artificial mutations to the various sites of the protein-coding region of ~5’3 may result in protein stabilization and enhancement of its im- mortalizing activity (Jenkins et al., 1985). These ex- periments open the possib~ty of p.53 gene activation by a natural mutation process. The search for naturally occurring mutations in tumors requires DNA sequencing of protein-coding regions and comparison with the structure of normal ~53 genes. Therefore, the assessment of normally occurring variations in the ~53 gene structure is important. Here we show that there are at least two variant forms of p5 gene having difIerences in BglII restric- tion sites and in the structure of codon 72. This pol~o~hism may account for variations in the electrophoretic mobility of human p53 isolated from different sources. MATERIALS AND METHODS a) DNA isolation and blot hybridization Genomic DNAs from human piacentas and from several human tumor strains maintained in ~~/~~ athymic mice (gift from Dr. E.S. Revasova) were isolated by the method of Blin and Statford (1976). Of each DNA 15 pg were digested with BgZII, separ- ated on a 1 y0 agarose gel, and transferred to nitro- cellulose filter (Schleicher & Schuell, BA 85) ac- cording to Southern (1975). Hybridization with DNA of human ~53 cDNA clone pR4-2 (Hat-low et al., 1985) labeled by nick-translation (Rigby et al., 1977) was carried out in 4 x SSC, 5 x Denhardt’s solution, 0.1 y0 SDS, 5 mM EDTA, 200 pug/ml of sheared denatured salmon sperm DNA at 68 *C for 16 h followed by ~gh-s~ngency washes. 1234 56 -9 kb / Fig. 1. The pattern of BglII DNA fragments hybridizing with a human ~53 cDNA “‘P-labeled probe. DNA preparations were from: lane 1, melanoma M2 tumor strain; lanes 2 and 3, normal human placentas; lane 4, Burkitt lymphoma P3H3; lane 5, kidney carcinoma tumor strain RP; lane 6, Burkitt lymphoma Namalwa. For procedures see MATERIALS AND METHODS, section a. -68 -45 -I? Fig. 2. Electrophoretic mobility of -labeled p53 protein preci- pitated from several cell lines with anti-p53 serum. For proce- dures see MATERIALS AND METHODS, sections b and c. Lanes: 1 and 2, melanoma M2; precipitation with nonimmune and anti-p53 serum, respectively; 3, Burkitt lymphoma Namalwa; precipitation with anti-p53 serum; 5, kidney carcino- ma RP; precipitation with anti-p53 serum. The positions of markers (in kDa) are indicated by arrows.  241 b) Analysis of p53 protein in tumor cell lines c) Isolation of genomic ~53 clones Several tumor cell lines were labeled with [ 35S]methionine (Amersham, > 800 Ci/mmol) for 3 h. The cells were washed with cold PBS and lysed for 10 min on ice with 1 ml of RIPA buffer per lo6 cells (RIPA buffer is 10 mM Tris * HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1 Triton X-100,1 Na * deoxycholic acid, 0.1 SDS, 50 pg/ml of apro- tinine). The extracts were cleared by centrifugation for 30 min at 100 000 x g at 4’ C. Equal quantities of acid-precipitable radioactivity were taken for immu- noprecipitation with anti-p53 polyclonal serum. Im- munoprecipitation and analysis by SDS-poly- acrylamide gel electrophoresis were carried out as described previously (Chumakov et al., 1982). EcoR I BamH I Hind III Bgl II Xba I Nco I Sac I Kpn I Pvu II stu I High-molecular-weight DNA from kidney carci- noma tumor strain RP was used for molecular cloning. A library of 15-20-kb fragments generated by partial digestion with zyxwvutsrqponmlkjihgfedcbaZ au A restriction endonu- clease was constructed and screened with 32P- labeled mouse ~53 cDNA probe, clone p2AM (Chumakov et al., 1988), as described by Maniatis et al. (1982). Five positive clones were isolated and characterized. Isolation of p53 gene from normal human placenta was carried out from a library constructed using 15-kb EcoRI fragments of placenta DNA. All of the p53-specific genomic clones were subcloned into pSP64 vector plasmid (Melton et al., 1984). Detailed I I I I II I II I I I I I I I I I I I I I I I I zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA   zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFE   zyxwvutsrqponmlkjihgfedcb   B I zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCB II I 1 I I I I I I I II I II I I I I I I I I II I I I I I I N 53-2 RP3 RP4 RP5 RP7 RP9 . C b -1kb Fig. 3. Genomic organization of the human ~53 gene. Human kidney carcinoma tumor strain RP having both variant forms of p53 gene was a source of DNA for molecular cloning. Five positive clones were isolated and characterized (RP3,4, 5, 7, and 9, map C). Three of the five genomic clones from RP tumor had an additional BglII site shown by arrows. We also cloned p53 gene from a library of 15-kb EcoRI fragments of normal human placenta that was homozygous for the gene represented by the 12-kb BglII fragment (clone N53-2, map C). Map A (black boxes, top line) shows the positions of mRNA-coding exons determined by Sl nuclease mapping and direct nucleotide sequencing. Map B shows the results of detailed restriction mapping of p.53 genomic clones (see MATERIALS AND METHODS, section c).  248 50 100 GGATTCCTCCIWAATGATTTCCACCAATTCTGC~CTCACAGCTC~~~GGCTTGCAG~TTTTCCACCCC~TGTTAGTATCTACGGCACCAGGTCGGC~AG~ 150 * 200 TCCTGACTCTGCACCCTCCTCCCCNlCTCCATTTCCATTTCCTTTGCTTCC~CCGGCAGGCGGATTACTTGCC~TTACTTGTCATGGCGACTGTCCAGCTTTGTGCCAG 250 300 GAGCCTCGCAGGGGTTGATGGGATTGGGGTTTTCCCCTCCCA~GTGCT~~GACTGGCG~T~~GT~TTGAGCTTCTC~GTCT~GAGCCACCGTCCAGG 350 400 GAGCAGGTAGCTGCTGGGCTCCGGGGACACTTTGCGTTCGGGCTG~GAGCGTGCTTTCCACGACGG~GACACGCTTCCCTGGATTGGqtaaqctcctgac~qa 450 -_ 10400 bp -- tggatCCtCttgCaqCAGCCAGACTGCC~T~CGGGTCACTGCC ATG GAG GAG CCG CAG TCA GAT CCT AGC GTC GAG Qfet Glu Glu Pro Gin Ser Asp Pro Ser Val Glu 500 550 CCC CCT CTG AG? CAG Pro Pro Lea SW Gin GA.A ACA TTT TCA GAC CTA TGG AAA CTgtgaqtqqatccattq -- 86 bp -- qctcttgactttcaqA CTT Glu Thr Phe Ser Asp Leu Trp Lys Leu L@U 600 CCT GAA AAC AX GTT CTGgtaaqqacaagqgtt -- 61 bp -- ttttcacccatctacagTCC CCC TTG CCG TCC CAA GCA ATG GAT Pro Glu Asn Asn Val Leu Ser Pi-o Leu Pro Ser Gin Ala Met ASP 650 GA' ? TG ATG CTG TCC Asp Leu Met Leu Ser CCC- GAC GAT ATT GAA CAA TGG TTC ACT GAA GAC CCA GOT Pro Asp Asp Ile Glu Gln Trp Phe Thr Glu Asp Pro Gly 750 GTG GCC CCT GCA CCA GCA GCT CCT ACA CCG GCG GCC CCT GCA CCA GCC CCC TCC TGG CCC CTG Val Ala Pro Ala Pro Ala Ala Pro Thr Pro Ala Ala Pro zyxwvutsrqponmlkjihgfedcbaZYXWVUTS la Pro Bla Pro Ser TrP Pro Lcu 850 TCA TCT TCT GTC CCT zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA CC CAG AAA ACC TAC CAG GGC AGC TAC GGT TTC CC-T CTG GGC TTC TTG CAT TCT GGG ACA GCC Ser Ser ser Val Pro Ser zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA in Lys Thr Tyr Gin Fly Ser Tyr Gly Phe Arg Leu Gly Phe Leu His Ser Gly Thr Ala 900 ACGgtcaqttgccctgaq -- 600 bp -- ttCctcttcctgcagTAC Thr Tyr 5000 950 AAG TCT GTG ACT TGC Lys Ser Val Thr Cys TCC CCT GCC CTC AAC AAG ATG TTT Ser Pro Ala Leu Am Lys Met Phe TGC CAA CTG GCC AAG CYS Gin Leu Ala Lys GCC ATC TAC X'xG CAG Ala Ile Tyr Lys Gin ACC TGC CCT GTG CAG CTG TGG GTT GAT TCC ACA CCC CCG CCC GGC ACC CGC GTC CGC GCC ATG Thr Cys Pro Val Gin Leu Trp Val Asp Ser Thr Pro Pro Pro Gly Thr Arg Val Arg Ala Met 1050 1100 TCA CAG CAC ATG ACG GAG GTT GTG AGG CGC TGC CCC CAC CAT GAG CGC "GC TCA GAT AGC GAT Ser Gin His Met Thr Glu Val Val Arg Arg Cys Pro His His Glu Arg Cys Ser Asp Ser ASP 1150 Ggtqaqcaqctqygqc -- 50 bp -- cactqattgctcttagGT CTG GCC CCT CCT CAG CAT CTT ATC CGA GTG GAA GGA AAT TTG GLy Leu Ala Pro Pro Gin His Leu Ile Arg Val Glu Gly Asn Leu 1200 CGT GTG GAG TAT TTG GAT GAC AGA AAC ACT TTT CGA CAT AGT GTG GTG GTG CCC Arg Val Glu Tyr Leu Asp Asp Arg Am Thr Phe Arg His Ser Val Val Val Pro a B 1300 act -- 700 bp -- qtqt ctcctagGTT GGC TCT GAC TGT ACC ACC ATC CAC TAC Vai Giy Ser Asp Cys Thr Thr Ile His Tyr AAC TAC ATG TGT AAC AGT TCC TGC Asn Tyr Met Cys Asn Sei Ser zyxwvutsrqpo YS 1350 1400 ATG GGC GGC ATG AAC CGG AGG CCC ATC CTC ACC ATC ATC ACA CTG GAA GAC TCC Met Gly Gly Met Asn Arg Arg Pro Ile Leu Thr Ile Ile Thr L,eu Glu Asp Ser AGqtCaqgagCCaCttq -- 350 bp -- SeYC 1450 cctatcctgaqtagT GGT AAT CTA CTG GGA CGG AAC AGC TTT GAG GTG CGT GTT TGT GcC TGT CCT GGG AGA GAC CGG CGC Gly Asn Leu Leu Gly Arg Asn Ser Phe Glu Val k-g Val Cys Ala cys Pro Giy Arg Asp Arg Arg 1500 1550 ACA GAG GAA GAG AAT CTC CGC AAG AM GGG GAG CCT CAC CAC GAG CTG CCC CCA Thr Glu Glu Glu Asn Leu Arg Lys Lys Gly Glu Pro His His Glu Leu Pro Pro GGG XC ACT AAG CGA Ggtaaqcaaqc Gly Ser Thr Lys Arg 1600 aqgac -- 62 bp -- ttgcctctttcctaqCA CTG CCC A7iC AAC ACC AGC TCC TCT CCC Ala Leu Pro Am Asn Thr Ser Ser Ser Prc 700 CCA GAT GM GCT CCC AGA ATG CCA Pro Asp 61~ fila Pro Arg Met Pro 1250 TAT GAG CCG CCT GAGgtctggtttgca Tyr Glu Pro Pro Glu CAG CCA AAG AAG AAA CCA CTG GAT Gln Pro Lys Lys Lys Pro Leu Asp 1650 1700 GGA GAA TAT TTC AC‘ CTT CAGgtactadgtcttqgg -- 2500 bp -- CtctgttgctgcaqATC CGT GGG CGT GAG CGC TTC GAG Gly Glu Tyr Phe Thr Leu Gin Ile Arg Gly Arg Glu Arg Phe Gin 1750 ATG TTC CGA GAG CTG AAT GAG GCC TTG GAA CTC MG GAT GCC CAG GCT GGG AAG GAG CCA GGG GGG AGC AGG GCT CAC Met Phe Arg Glu Leu Asn Glu Ala Leu Glu Leu Lys Asp Ala Gin Ala Gly Lys Glu Pro Gly Gly SW Arg Ala His 1800 1850 TCC AGgtgagtgacctcagc -- 1000 bp -- TCttCtg3XtCCtaCagc CAC CTG AAG TCC AAA AAG GGT CAG TCT ACC TCC CGC Ser Ser His Leu Lys Ser Lys Lys Gly Gin Ser Thr Ser Arg 1900 CAT AAA AA& CTC ATG TTC AAG ACA GM GGG CCT GAC TCA GAC TGA His Lys Lys Leu ?tet Phe Lys Thr Flu Cly Pro Asp Ser Asp STOP CCCCA  249 zyxwvut 2000 2050 TCTCTCCCTCCCCTGCCATTTTGGGTTTTGGGTCTTTGAAGCACCCAGGACTTCCATTTGCTTTGTCCCGGGGC 2100 2150 TCCACTGAACAAGTTGGCCTGCACTGGTGTTTTGTTGTGGGGAGGAGGATGGGGAGTAGGACATACCAGCTTAGATTTT~GGTTTTTACTGTGAGGGATGTT 2200 2250 TGGGAGATGTAAGAAATGTTCTTGCAGTTAAGGGGTTAGTTTAC~TCAGCCACATTCTAGGTAGGGGCCCACTTCACCGTACTAACCAGGGAAGCTGTCCCTC 2300 2350 ATGTTGAATTTTCTCT~CTTCAAGGCCCATATATCTGTG~TGCTGGCATTTGCACCTACCTCACAGAGTGCATTGTGAGGGTT~TGA~TMTGTACATCT 2400 2450 GGCCTTGAAACCACCTTTTATTACATGGGGTCTAAAACTTGACCCCCTTGAGGGTGCCTGTTCCCTCTCCCTCTCCCTGTTGGCTGGTGGGTTGGTAGTTTCT 2500 ACAGTTGGGCAGCTGGTTAGGTAGAGGGAGTTGTCAAGTCCCTCTTGGT ii CCTTAGTACCTAAAAGGAAAT 2600 2650 CTCACCCCATCCCACACCCTGGAGGATTTCATCTCTTGTATATGATGATCTGGATCCACC~GACTTGTTTTATGCTCAGGGTC~TTTCTTTTTTCTTTTTT 2700 2750 TTTTTTTTTTTTCTTTTTCTTTGAGACTGGGTCTCGCTTTGTTGCCCAGGCTGGAGTGGAGTGGCGTGATCTTGGCTTACTGCAGCCTTTGCCTCCCCGGCTC 2800 2850 GAGCAGTCCTGCCTCAGCCTCCGGAGTAGCTGGGACCACAGGTTCATGCCACCATGGCCAGCCMCTTTTGCATGTTTTGTAGAGATGGGGTCTCACAGTGTT 2900 2950 GCCCAGGCTGGTCTCAAACTCCTGGGCTCAGGCGATCCACCTGTCTCAGCCTCCCAGAGTGCTGGGATTACMTTGTGAGCCACCACGTCCAGCTGG~GGGT 3000 3050 CAACATCTTTTACATTCTGCAAGCACATCTGCACATCTGCATTTTCACCCCACCCTTCCCCTCCTTCTCCCTTTTTATATCCCATTTTTATATCGATCTCTTATTTTAC~ - 3100 TAAAACTTTGCTGCCACCTGTGTGTCTGAGGGGTGAACGCC Fig. 4. Nucleotide sequence of the allele with an additional BgZII site of the human p.53 gene. Sequencing is described in MATERIALS AND METHODS, section d. Boxed areas mark the differences between the alleles with and without the additional BgZII site. The structure of intron stretches is shown in lower case print. The predicted amino acid sequence of the p53 protein is shown along the protein-coding region ofthe p53 gene. A downward arrow marks the putative mRNA start point (Lamb and Crawford, 1986); an upward arrow shows the last nucleotide found in the cDNA clone (Matlashewski et al., 1984). The position of the 3’ end of ~53 mRNA was also confirmed by our S 1 mapping experiments. The polyadenylation signal sequence is underlined. restriction mapping was carried out by digestion with combinations of restriction endonucleases and cross-hybridization with 32P-labeled individual DNA fragments. d) Nucleotide sequencing of the coding regions of p53 gene The mRNA-coding regions of gene ~53 were de- termined by Sl nuclease mapping (Favaloro et al., 1980) using 32P-labeled fragments of cloned genomic p53 DNA and in vitro-synthesized p53 RNA com- plementary to the human cDNA clone pR4-2 (Harlow et al., 1985). Genomic DNA fragments in the regions of exons were subcloned and used for DNA sequencing by the method of Maxam and Gilbert (1977), as modified by Chuvpilo and Kravchenko (1985). mRNA coding regions and adjacent stretches of introns of both the allelic forms of ~53 gene from RP tumor were sequenced. RESULTS AND DISCUSSION a) BgZII site polymorphism We have undertaken a search for possible variations in the structure of human p53 gene. An extensive analysis of the DNA from 34 malignant tumors and from 13 normal placentas digested with restriction endonucleases EcoRI, Hind111 and BumHI revealed uniform patterns of the p53-specific fragments (results are not shown). In contrast, when BgZII restriction endonuclease was used, a variable pattern was observed (Fig. 1). The majority of the DNA preparations has a single 12-kb fragment hybridizing with cloned p53 cDNA probe. However, the DNA preparations from six malignant (18 ) and from three normal placentas (23 ) gave an additional 9-kb Bg211 fragment that was present along with the 12-kb fragment. Only in one case (Burkitt lymphoma Namalwa; Fig. 1, lane 6), a
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks