Reports

Absence of GJB6 mutations in Indian patients with non-syndromic hearing loss

Description
Absence of GJB6 mutations in Indian patients with non-syndromic hearing loss
Categories
Published
of 4
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Absence of GJB6 mutations in Indian patients with non-syndromic hearing loss Seema Bhalla a , Rajni Sharma a , Gaurav Khandelwal a , Naresh K. Panda a , Madhu Khullar b, * a Department of Otolaryngology and Head and Neck Surgery, Post Graduate Institute of Medical Education and Research, Chandigarh 160012, India b Department of Experimental Medicine and Biotechnology, Post Graduate Institute of Medical Education and Research, Chandigarh 160012, India 1. Introduction Hearing impairment is the most common disorder of sensori-neural functions. Approximately one child in 1000 is born withmoderate to profound hearing impairment [1]. It is estimated thatatleast50%ofprelingualhearinglossiscausedbygeneticchanges.Approximately80%ofcasesofgeneticdeafnessarenon-syndromicandautosomalrecessiveformsarethemostcommoninthisgroup[2]. Non-syndromic hearing loss (NSHL) is genetically heteroge-neous and at least 120 genetic loci for NSHL and greater than 60loci are known for autosomal recessive NSHL (ARNSHL) (Heredi-tary Hearing Loss Homepage: http://webh01.ua.ac.be/hhh/). De-spite large number of genetic loci that have been characterized forARNSHL, mutations at DFNB1 locus [encompassing GJB2 and GJB6genes] have been found to be responsible for more than half of autosomal recessive NSHL in various populations in both sporadicand familial cases [3–5]. GJB2 and GJB6 genes encode for two gap junction proteins, connexin 26 (MIM # 121011) and connexin 30(MIM # 604418) respectively and are expressed in cochlea andencode for transmembrane protein subunit of intercellular gap junctions [6]. Mutations in GJB2 and GJB6 genes disrupt therecycling of potassium ions to the endolymph, resulting inprogressive intoxication of the organ of corti [7], thereby leadingto cellular dysfunction, cell death and ultimately hearing loss. Upto 50% of all patients with autosomal recessive non-syndromicprelingualdeafnessindifferentpopulationshavemutationsintheGJB2 gene. However, a large fraction (10–42%) of patients withGJB2mutationshasonlyonemutantalleleatthatlocus,andsomefamilial cases have evidence of linkage to the DFNB1 locus buthave no mutation in GJB2. It was therefore hypothesized thatanother gene close to  GJB2  might be responsible for these casesand mutations in GJB6 gene lying close to GJB2 may contribute tothesehearinglosscases.GJB6mutationshavebeenreportedtobeassociated with both autosomal dominant hearing loss [8] andautosomal recessive hearing loss. Several recent studies haveillustrated two large deletions, del(GJB6-D13S1830) anddel(GJB6-D13S1854), involving GJB6 gene may be most commonsecondmutations causing ARNSHLin several populations suchasSpain, France, Israel, Brazil, Belgium and Australia [9,10].Inherited hearing impairment has long been recognized in India,however, spectrum of GJB6 mutations for Indian populations islacking. Since GJB2 and GJB6 genes are lying close to each otheranddigenicinheritancehasbeenreportedforthesetwogenes,weexamined the GJB6 gene in NSHL patients who were negative forGJB2 sequence variants or were carrying monoallelic GJB2variants. International Journal of Pediatric Otorhinolaryngology 75 (2011) 356–359 A R T I C L E I N F O  Article history: Received 17 September 2010 Received in revised form 6 December 2010 Accepted 6 December 2010 Available online 11 January 2011 Keywords: Non-syndromic hearing lossGJB2GJB6Connexin A B S T R A C T Objective:  Hearinglossisthemostfrequentsensorydefectinhumanbeing.Geneticfactorsaccountforatleasthalfofallcasesofprofoundcongenitaldeafness.The13q11–q12regioncontainstheGJB2andGJB6genes, which code connexin 26 (CX26) and connexin 30 (CX30) proteins, respectively. Mutations in thegeneGJB2,encodingthegapjunctionproteinconnexin26,areconsideredtoberesponsibleforupto50%offamilialcasesofautosomalrecessivenon-syndromichearinglossandforupto15–30%ofthesporadiccases. It has also been reported that mutations in the GJB6 gene contribute to autosomal recessive andautosomaldominanthearingdefectsinmanypopulations.The342-kbdeletion[del(GJB6-D13S1830)]of the Cx30 gene is the second most common connexin mutation after the CX26 mutations in some NSHL populations. The aim of this study was to screen GJB6 gene mutations in Asian Indian patients withautosomal non-syndromic hearing loss. Methods:  We screened 203 non-syndromic hearing loss patients, who were negative for homozygousmutations in GJB2 gene, for GJB6-D13S1830 deletion and mutations in coding regions of GJB6 usingpolymerase chain reaction, denaturing high performanceliquid chromatography and direct sequencing. Results:  No deleterious mutation in GJB6 gene was detected in our study cohort. Conclusion:  The present data demonstrated that mutations in the GJB6 gene are unlikely to be a majorcause of non-syndromic deafness in Asian Indians.   2010 Elsevier Ireland Ltd. All rights reserved. * Corresponding author. Tel.: +91 172 2755229; fax: +91 172 2744401. E-mail address:  profmkhullar@gmail.com (M. Khullar). Contents lists available at ScienceDirect International Journal of Pediatric Otorhinolaryngology journal homepage: www.elsevier.com/locate/ijporl 0165-5876/$ – see front matter    2010 Elsevier Ireland Ltd. All rights reserved.doi:10.1016/j.ijporl.2010.12.003  2. Materials and methods 203 prelingual patients diagnosed with NSHL, attending outpatient department of Otolaryngology Department, Post GraduateInstitute of Medical Education and Research, Chandigarh, Indiafrom March 2004 to November 2007 were enrolled in the presentstudy. The study was approved by the institute ethics committeeand informed consent was obtained from all the individuals priortoenrollment.Detailedmedicalandfamilyhistorieswereobtainedthrough a questionnaire; all individuals were evaluated by clinicalexamination including otoscopic exploration and pure-toneaudiometry. The srcin of study subjects was confirmed basedon their mother language, ancestral history and marital relation-ships.Patients were divided into 3 groups: Group 1 included 137unrelated individuals with nonsyndromic hearing impairment (71malesand66females)withoutanyfamilyhistoryofNSHL.Group2consisted of 63 subjects (36 males and 27 females) with familyhistoriesofhearingimpairment,whichappearedtobeinheritedinautosomal recessive mode, 23 of these patients belonged tofamilies with two or more deaf siblings (17 males and 6 females).Group 3 comprised of 101 normal hearing unrelated individualsincluding 52 males and 49 females originating from samegeographic region as patients. Syndromic forms and patientswho had possible environmental etiology, i.e., viral infections,meningitis, acoustic trauma, or exposure to ototoxic drugs, werenot included in this study. Syndromic conditions were excludedafterathoroughclinicalexamination.Anyassociatedmiddleearorinner ear anomalies were excluded by computerized tomographyscan of the temporal bone and magnetic resonance imaging. Thiswas the standard protocol adopted in all the patients. To excludeviral etiology, IgG and IgM titres were determined in the patients.  2.1. Audiometric testing  Audiometric analysis was performed to diagnose the NSHL andto measure the severity of hearing loss. A detailed examinationincluding otoscopy was carried out in all the subjects to rule outany evidence of syndrome. Hearing levels were measured by puretoneaudiometry.Puretonethresholdswereobtainedat0.5,1,2,3,4, 6 and 8 kHz. The degree of hearing impairment was based onaverage threshold calculated over frequencies of 0.5, 1 and 2 kHz[pure-tone average = PTA 0.5–2 kHz ] in the better ear. Hearingimpairment was then categorized following the guidelines of GENDEAF study; Group HL is defined as mild with a PTA 0.5–2 kHz 21–40 dB, moderate with a PTA 0.5–2 kHz  41–70 dB, severe with aPTA 0.5–2 kHz  71–95 dB, and profound with a PTA 0.5–2 kHz  greater orequal to 95 dB. The shape of the audiogram and presence of asymmetry [defined as a 10 dB difference between ears at threefrequencies, 15 dB at two frequencies, or 20 dB difference at onefrequency] were also noted. In young children, behavioralaudiometry was used to determine the auditory thresholds infree field conditions. All subjects underwent ABR (auditorybrainstem response) assessment to objectively determine thehearing levels. Impedance audiometry including tympanometryand stapedial reflex (Madsen Orbiter 901,226 Hz probe) was donetoruleoutanymiddleearabnormality.TypeAcurvewaswhenthepeak was between  100 daPa and 200 daPa and static compliancewas between 0.25 ml and 1.5 ml, type B was when staticcompliance was lower than 0.25 ml and type C when the peakwas greater than 0.25 ml but the pressure was less than  100 daPa. Otoacoustic emissions (OAE) were also done in allthe patients.  2.2. Mutation detection for GJB2 Genomic DNA was extracted from whole blood followingstandard phenol–chloroform method. All patients and controlsubjects were initially screened for six known GJB2 mutations(35delG, W24X, W77X, Q124X, 167delT and 235delC) using PCR-RFLP and AS-PCR assays [11]. 51 patient samples, which wereheterozygous for known GJB2 mutations and 152 patient samples,which were found to be negative for tested GJB2 mutations, werescreened to identify other mutations in coding and non-codingexons of GJB2 by direct sequencing. The complete coding region of GJB2 was PCR amplified using previously described method [11].  2.3. Mutation detection for GJB6  Patients without GJB2 sequence variants ( n  = 152) as well asthose carrying monoallelic GJB2 sequence variants ( n  = 51) wereanalyzed for del(GJB6-D13S1830) deletion [10]. Subsequently, wescreened these patients for other mutations in the coding regionsof the GJB6 genes.  2.4. GJB6 gene analysis The entire coding region of GJB6 gene was amplified in fouroverlapping fragments using the primer pairs shown in Table 1.These amplicons were screened for the presence of variants bydenaturing high-performance liquid chromatography (DHPLC)followed by direct sequencing. Mutation screening was carriedout using WAVE DNA fragment analysis system equipped withautosampler(TransgenomicWAVEsystemD7000IFequippedwithan autosampler). Prior to injection in the WAVE system, the PCR productsweredenaturedtoallowtheformationofheteroduplexesfor mutation detection by DHPLC. 10 m l of the PCR product washeat denatured at 95  8 C for 5 min and then allowed to cool in 5  8 Cdecrements until 25  8 C was reached. Mutation detection indifferent amplicons was done at their respective meltingtemperatures (Table 1). Briefly, 10 m l of PCR product was injectedinto the preheated column made up of non-porous matrixconsisting of polystyrene–divinylbenzene (PS–DVB) co-polymerbeads that are alkylated with C-18 chains. Triethyl-ammoniumacetate (TEAA) was used as a bridging molecule that helped in theadsorption of nucleic acid on the column as column is neutral incharge and not readily reacts with nucleic acid. DNA from thecolumnwaselutedoutusingalinearacetonitrilegradientthatwas  Table 1 Primer pairs and DHPLC conditions for GJB6 gene analysis.Spanning region Primers Amplicon size (bp) DHPLC  T  m  ( 8 C)Exon 2 Chr13: 19695406–19695638 F: TCAGGGATAAACCAGCGCAATR: ACACCGGGAAAAAGTGGTCAT233 62.3Exon 2 Chr13: 19695192–19695479 F: GCAAGAGGACTTCGTCTGCAACAR: CGGAAAAAGATGCTGCTGGTGT288 60.2Exon 2 Chr13: 19694976–19695253 F: AAGCACAAGGTTCGGATAGAGGR: AGCAGCAGGTAGCACAACTCTG278 59.6Exon 2 Chr13: 19694767–19695045 F: CCATTTTTATGATTTCTGCGTCTGR: GTTGGTATTGCCTTCTGGAGAAGA279 58.0 S. Bhalla et al./International Journal of Pediatric Otorhinolaryngology 75 (2011) 356–359  357  formed by mixing two buffers used in the DHPLC: Buffer A(0.1 mol/L TEAA, pH 7.0] and Buffer B (0.1 mol/L TEAA, pH 7.0, 25%acetonitrile). DNA was eluted at a constant flow rate of 1.5 ml/minandmonitoredbytakingtheabsorbanceat260 nm.Meltingcurvesfor each of the amplicons were predicted using software WAVE-MAKER (Transgenomics). Amplified samples were run throughDHPLC and the elution profiles were examined. Abnormal elutionprofiles were sequenced.The PCR products were purified using Microspin S400 columns(Amersham Pharmacia) and sequenced using specific primers andABIPRISMBigDyeTerminatorcyclesequencingreadyreactionkit.The sequenceswere analyzed on an ABI PRISM3730 DNA analyzer(Applied Biosystems). The sequence of each amplicon wasconfirmed by bi-directional sequencing and was compared withthe GJB6 reference sequence. Alignments and analysis wereperformed using clustal X version 1.8 (http://www.molbiol.ox.ac.uk/documentation/clustalx/clustalx.html). 3. Results Inthepresentstudy,203NSHLpatientsand100normalhearinghealthycontrolswereinvestigatedformutationsinGJB6genes.Allsubjects belonged to Indo-European linguistic group. All NSHL patients, except one belonged to non-consanguineous families.Majority of subjects exhibited bilateral, severe to profoundsensorineural hearing impairment while 37 patients presentedwith asymmetric hearing loss.Audiometric testing revealed that only one patient had ‘B’ typeof graph on tympanometry, but his PTA showed profound hearinglossandhehadhistoryofhearinglosssincebirth.Onepatienteachhad type ‘C’ curve in right ear and left ear while other ear had type‘A’. Rest all other patients had type ‘A’ curve. Acoustic reflex andevoked OAE was absent in all patients.Eight patients (27.6%) had GJB2 variations; 6.2% were familialand 21.4% were sporadic cases. 7/58 (12.1%) probands with GJB2mutations had affected siblings. We identified four knownmutations; 35delG, W24X, W77X and delE120 in our cohort. Inaddition to these mutations, two polymorphisms, R127H andV153I were also observed. Of 203 patients, 51 showed onlymonoallelic GJB2 variants [11].del(GJB6-D13S1830)detectionwasdoneusingamultiplexPCR.Generation of a 705 bp fragment indicates that the centromericregion of the gene is intact. Amplification of a 310 bp genefragment indicates that the telomeric region of the gene is intact.342-kb deletion is detected by the amplification of the fusionproduct as a 460 bp fragment. We did not observe del(GJB6-D13S1830) in our study population.Further, we amplified entire coding region of GJB6 gene in fouroverlapping fragments and screened these amplicons for thepresenceofvariantsbyDHPLC.DHPLCrevealedthepresenceoffewprobable variants however no change in the nucleotide sequencewas detected when direct sequencing was performed. Theseprobable variants represent the false positives detected duringscreeningofexon2ofGJB6geneusingDHPLC.Wedidnotfindanymutation in exon 2 of GJB6 gene in patients as well as controls. 4. Discussion Although GJB2-related hearing loss is considered a recessivegenetic disorder, ithasbeenreportedthat10–42%of patientswithGJB2 mutations have only one mutant GJB2 allele (http://www.uia.ac.be/dnalab/hhh/). It has been proposed that othermutations might exist in the neighboring gene GJB6 that couldprovide an explanation for the high proportion of heterozygousaffected subjects. A novel class of mutations was detected in theDFNB1 locus, which involved deletions not affecting GJB2 buttruncatingtheneighboringGJB6gene.This342 kbdeletion,named‘del(GJB6-D13S1830)’wasfoundtobetheaccompanyingmutationin approximately 50% of the deaf GJB2 heterozygotes [12]. GJB6gene has not been studied well in Indian population and its role inNSHL patients from India is unknown.In the present study, we did not observe del(GJB6-D13S1830)deletion in any proband from non-consanguineous North Indiancohort suggesting that this GJB6 deletion may not contribute tohearing impairment in our study population. Our findings aresupported by a recent study by Padma et al. which has alsoreportedabsenceofdel(GJB6-D13S1830)oranypointmutationsinGJB6geneinNSHLsubjectsfromSouthIndia[13].Previousstudiesfrom other ethnic populations have also reported the absence of del GJB6-(D13S1830) deletions in NSHL patients in Japanese [14],Turkish [15], African American and Caribbean Hispanic [16] and Moroccan populations [17], Chinese patients [18] and Jordanian patients [19]. More recently, analysis of a large unselectednewborn population group from New York State also failed todetect this deletion [20]. Absence of del(GJB6-D13S1830) inhearing loss patients with different ethnicities indicates that thisdeletion is restricted to certain populations and is likely to be rareor absent in Indian population. However contrary to our findings,this deletion ‘‘del(GJB6-D13S1830)’’ was found to be the secondmostfrequentmutationcausingprelingualdeafnessintheSpanishand French populations [12]. This deletion truncating the GJB6gene was shown to be the accompanying mutation in approxi-mately 50% of deaf GJB2 heterozygotes in cohort of Spanishpatients,thusbecomingsecondonlyto35delGatGJB2asthemostfrequent mutation causing prelingual hearing impairment inSpain. A multicenter study conducted in 9 countries, showed thatthe del(GJB6-D13S1830) is present in most of the screeningpopulations, with higher frequencies in France, Spain, and Israelthus indicating ethnic variation in prevalence of this deletion [20].Analysis of haplotypes associated with this deletion revealed afounder effect in Ashkenazi Jews and also suggested a commonfounder for countries in Western Europe [9]. Seeman et al.concluded that the del(GJB6-D13S1830) is very rare in centralEurope compared to reports from Spain, France, and Israel [21]. Ithas since been suggested that the del(GJB6-D13S1830) mutationhas a relatively high carrier frequency, albeit variable betweenpopulations [20], and may be a significant co-contributor to non-syndromic deafness in some populations.Although, del(GJB6-D13S1830) has been shown to act as arecessive mutation with classical monogenic inheritance, thisdeletion has also been reported to present in pedigrees withdigenic inheritance associated with GJB2 alleles leading todeafness [12,22]. Homozygosity for del(GJB6-D13S1830) repre-sents less than 0.5% of all cases of worldwide prelingual hearingloss and in USA the number is much lower [9]. The overallincidence of GJB2/GJB6 deafness was found to be 2.57% in a studyconducted in a large North American repository of deaf probands[23]. In 255 French patients with a phenotype compatible withDFNB1, Feldmann et al. found that 32% had biallelic GJB2mutations, and 6% were heterozygous for a GJB2 mutation andthe del(GJB6-D13S1830) deletion [24]. The deletion was alsodetectedintransin4/6hearinglosspatientsheterozygousforGJB2mutations and in homozygous state in one case of congenitalprofound deafness from France [25]. Stevenson et al. found that 4/20 (20%) of the GJB2 heterozygotes were heterozygous fordel(GJB6-D13S1830) and recommended deletion analysis for allGJB2 heterozygous individuals [26]. Moreover, the deletion wasfound in seven NSHL patients being heterozygous for GJB2mutations from four unrelated Ashkenazi Jewish families [27].Since all the 51 NSHL patients carrying monoallelic GJB2variants were found to be negative for del(GJB6-D13S1830) in ourstudy population, we screened the entire coding region of GJB6 S. Bhalla et al./International Journal of Pediatric Otorhinolaryngology 75 (2011) 356–359 358  gene for the presence of variants which may be responsible forNSHLinthesesubjects.NoneofpatientscarryingmonoallelicGJB2variants as well as the patients found to be negative for GJB2variants showed the presence of any GJB6 variants. Our results arein agreement with a previous report which detected no significantmutations in the GJB6 gene in a screening of 23 dominant familiesand 64 American and 30 Japanese recessive families with non-syndromichearingloss[14].ThesefindingssuggestthatvariantsinGJB6 gene are not common cause of hearing impairment in ourcohort. The spectrum of GJB6 mutations has not been studiedearlierinIndiansubcontinentandourresultssuggestrestrictionof the GJB6 mutations to certain populations. 5. Conclusions Insummary,ourdatashowsanabsenceofdel(GJB6-D13S1830)and other GJB6 mutations in North Indian population. Further, ourresults indicate that loci other than GJB2 and GJB6 may contributeto the pathogenesis of ARNSHL in our population and that the fullspectrumofgenesinvolvedinNSHLinIndianpopulationisnotyetfully elucidated. Conflict of interest The authors report no declarations of interest.  Acknowledgement The authors thank Indian Council of MedicalResearch, Indiaforproviding with the financial assistance to carry out this work. References [1] J. Nadal, Hearing loss, N Engl J Med 329 (1993) 1029–1102.[2] N.E. Morton, Genetic epidemiology of hearing impairment, Ann N Y Acad Sci 630(1991) 6–31.[3] K.P. Steel, Anew era inthe geneticsof deafness, New EngJMed 339 (1998) 1545–1547.[4] J.H. Xia, C.Y. Liu, B.S. Tang, Q. Pan, L. Huang, H.P. Dai, et al., Mutation in theencoding gap junction protein beta-3 associated with autosomal dominanthearing impairment, Nat Genet 20 (1998) 370–373.[5] A. Kenneson, K. Van Naarden Braun, C. Boyle, GJB2 (connexin 26) variants andnonsyndromic sensorineural hearing loss: a HuGE review, Genet Med 4 (2002)258–274.[6] D.P. Kelsell, J. Dunlop, H.P. Stevens, N.J. Lench, J.N. Liang, G. Parry, et al., Connexin26 mutations in hereditary non-syndromic sensorineural deafness, Nature 387(1997) 80–83.[7] P.P.Lefebvre,T.R.VanDeWater,Connexins,hearinganddeafness:clinicalaspectsofmutationsintheconnexin26gene,BrainResBrainResRev32(2000)159–162.[8] A. Grifa, C.A. Wagner, L. D’Ambrosio, S. Melchionda, F. Bernardi, N. Lopez-Bigas,et al., Mutations in GJB6 cause nonsyndromic autosomal dominant deafness atDFNA3 locus, Nat Genet 23 (1999) 16–18.[9] I. Del Castillo, M.A. Moreno-Pelayo, F.J. Del Castillo, Z. Brownstein, S. Marlin, Q.Adina, et al., Prevalence and evolutionary srcins of the del (GJB6-D13S1380)mutation in the DFNB1 locus in hearing impaired subjects: a multicenter study,Am J Hum Genet 73 (2003) 1452–1458.[10] F.J. Del Castillo, M. Rodrı´guez-Ballesteros, A. Alvarez, T. Hutchin, E. Leonardi, C.A.de Oliveira, et al., A novel deletion involving the connexin-30 gene, del (GJB6-D13S1830), found in trans with mutations in the GJB2 gene (connexin 36) insubjects with DFNB1 non-syndromic hearing impairment, J Med Genet 42 (2005)588–594.[11] S.Bhalla,R.Sharma,G.Khandelwal,N.K.Panda,M.Khullar,LowincidenceofGJB2,GJB6 and mitochondrial DNA mutations in North Indian patients with non-syndromic hearing impairment, Biochem Biophys Res Commun 385 (2009)445–448.[12] I. Del Castillo, M. Villamar, M.A. Moreno-Pelayo, F.J. Del Castillo, A. Alvarez, D.Telleria, et al., A deletion involving the connexin 30 gene in non-syndromichearing impairment, N Engl J Med 346 (2002) 243–249.[13] G. Padma, P.V. Ramchander, U.V. Nandur, T. Padma, GJB2 and GJB6 gene muta-tions found in Indian probands with congenital hearing impairment, J Genet 88(2009) 267–272.[14] P.M. Kelley, D.J. Harris, B. Comer, J.W. Askew, T. Fowler, S.D. Smith, et al., Novelmutations in the connexin 26 gene (GJB2) that cause autosomal recessive(DFNB1) hearing loss, Am J Hum Genet 62 (1998) 792–799.[15] O. Uyguner, M. Emiroglu, A. Uzumcu, G. Hafiz, A. Ghanbari, N. Baserer, et al.,Frequencies of gap- and tight-junction mutations in Turkish familieswith autosomal-recessive non-syndromic hearing loss, Clin Genet 64 (2003)65–69.[16] J. Samanich, C. Lowes, R. Burk, S. Shanske, J. Lu, A. Shanske, et al., Mutations inGJB2, GJB6, and mitochondrial DNA are rare in African American and CaribbeanHispanicindividualswithhearingimpairment,AmJMedGenet143A(2007)830–838.[17] O. Abidi, R. Boulouiz, H. Nahili, M. Ridal, M.N. Alami, A. Tlili, et al., GJB2 (connexin26) gene mutations in Moroccan patients with autosomal recessive non-syn-dromic hearing loss andcarrierfrequencyof the commonGJB2-35delG mutation,Int J Pediatr Otorhinolaryngol 71 (2007) 1239–1245.[18] X. Liu, X.J. Xia, X.M. Ke, X.M. Ouyang, L.L. Du, Y.H. Liu, et al., The prevalence of connexin 26 (GJB2) mutations in the Chinese population, Hum Genet 111 (2002)394–397.[19] A.A. Mahasneh, M.H. Al-Asseer, Screening of GJB6 gene for the 342-kb deletion inpatients from Jordan with non syndromic hearing loss, Int J Hum Genet 5 (2005)253–257.[20] T. Fitzgerald, S. Duva, H. Ostrer, K. Pass, C. Oddoux, R. Ruben, et al., The frequencyof GJB2 and GJB6 mutations in the New York State newborn population: feasibil-ity of genetic screening for hearing defects, Clin Genet 65 (2004) 1–6.[21] P. Seeman, O. Bendova´, D. Raskova´, M. Malı´kova´, D. Groh, Z. Kabelka, Heterozy-gosity with mutations involving both the GJB2 and GJB6 genes is a possible, butvery rare, cause of congenital deafness in the Czech population, Ann Hum Genet69 (2005) 9–14.[22] B. Teubner, V. Michel, J. Pesch, J. Lautermann, M. Cohen-Salmon, G. So¨hl, et al.,Connexin30 (Gjb6)-deficiency causes severe hearing impairment and lack of endocochlear potential, Hum Mol Genet 12 (2003) 13–21.[23] A. Pandya, K.S. Arnos, X.J. Xia, K.O. Welch, S.H. Blanton, T.B. Friedman, et al.,Frequency and distribution of GJB2 (connexin 26) and GJB6 (connexin 30)mutations in a large North American repository of deaf probands, Genet Med5 (2003) 295–303.[24] D.Feldmann,F.Denoyelle,P.Chauvin,E.N.Garabe´dian,R.Couderc,S.Odent,etal.,Large deletion of the GJB6 gene in deaf patients heterozygous for the GJB2 genemutation: genotypic and phenotypic analysis, Am J Med Genet A 15 (2004) 263–267.[25] N.Pallares-Ruiz,P.Blanchet,M.Mondain,M.Claustres,A.F.Roux,Alarge deletionincludingmostofGJB6inrecessivenonsyndromicdeafness:adigeniceffect?Eur J Hum Genet 10 (2002) 72–76.[26] V.A. Stevenson, M. Ito, J.M. Milunsky, Connexin-30 deletion analysis in connexin-26 heterozygotes, Genet Test 7 (2003) 151–154.[27] I.Lerer,M.Sagi,Z.Ben-Neriah,T.Wang,H.Levi,D.Abellovich,Adeletionmutationin GJB6 cooperating with a GJB2 mutation  in trans  in non-syndromic deafness: anovel founder mutation in Ashkenazi jews, Hum Mutat 18 (2001) 460. S. Bhalla et al./International Journal of Pediatric Otorhinolaryngology 75 (2011) 356–359  359
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks