Self-Help

Absence of HTLV-1 related sequences in MS from high prevalence areas in Western Norway

Description
Absence of HTLV-1 related sequences in MS from high prevalence areas in Western Norway
Categories
Published
of 4
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  SCANDINAYICA z SSN zyx 001 6.3 zyx 4 Absence of HTLV-1 related sequences in MS from high prevalence areas in Western Norway Myhr KM, Frost zyxwvutsr , Granning M, Midgard R, Kalland KH, Helland DE Nyland HI. Absence of HTLV-1 related sequences in MS from high prevalence areas in western Norway. Acta Neurol Scand 1994: 89: 65-68. zyxwvu   Munksgaard 1994. In Western Norway, long-term follow up epidemiological studies have revealed significant increases in the incidence and prevalence rates of niultiple sclerosis (MS) in stable populations. indicating the impact of exogenous factors. In this study 183 MS patients and 102 controls from high prevalence areas in Western Norway were investigated for human T-lymphotropic virus type I (HTLV-1) related sequences by polymerase chain reaction. Using primers targeting the gug pol and zyxwvut Hv genes in the HTLV-1 provirus genome, no amplification products were detected in the 183 MS patients or 102 controls. The results strongly suggest that neither HTLV-1 nor a closely related retrovirus participate in the netiology of MS. Multiple sclerosis (MS) is a demyelinating disease of the central nervous system (CNS) of unknown acti- ology. The susceptibility to MS is determined by genetic factors (I), but epidemiological data suggest an additional role of environmental factors, either an unusual reaction to an ubiquitious agent, or the con- sequence of a rare infectious event. Several viruses have been incriminated (2, 3), but none of them have been proven to be the causal agent in the pathogcn- esis of MS. The similarity between MS and tropical spastic paraparesis (TSP), a human T-lymphotropic virus type I (HTLV- zyxwvutsr ) associated chronic demyelinating myelopathy, led to the search for retroviruses as putative factors in the development of MS. In 1985, Koprowski er nl reported the finding of anti-HTLV- 1 p24 in some MS patients (4). However, attempts by other groups using different serological techniques gave inconclusive results, for review see Prayoonwi- wat zyxwvutsrqp r nI(5). In 1989, using polymerase chain reac- tion (PCR) and molecular cloning, Reddy et nlfound retrovirus sequences homologous to HTLV-1 in all of the six MS patients investigated (6). Recently, however, several groups have reported lack of evi- dence of retrovirus sequences in genomic DNA from MS patients 5, 7-25). In the present study DNA samples from 183 MS patients were amplified with K. M. Myhr,lf2, P. Frost’, M. Gr~nning~, R. Midgard4, K. H. Kalland3, D. E. Helland’,H. I Nyland.’ ’ Center of Biotechnology, Department of ’ eurology. Microbiology and Immunology, University of Bergen, Neurology, Molde County Hospital, Norway Key words: multiple sclerosis, retrovirus, human T-lymphotropic virus type I, polymerase chain reaction. Kjell-Morten Myhr, Department of Neurology. University of Bergen. N-502 1 Bergen, Norway Accepted for publication June 16, 1993 three pairs of HTLV-1 primers included those pub- lished by Reddy et nI(6). Material and methods The patient group includes 183 MS patients (Table I . One group of 155 patients comprises all patients with clinical onset of MS in the county of Hordaland in the period 1976-1986. Another group of 28 patients includes all patients constituting a local MS cluster in Vestnes and Fraena municipali- ties in the county of Mplre and Roriisdal. The MS patients were diagnosed and classified according to the criteria of Bauer (26).The control group includes 102. patients as described in Table 1. Positive con- trols were blood cells obtained from a HTLV-1 se- ropositive black male with adult T-cell leukeaniia (ATL), a HTLV-1 infected cell line C9IPL and a HTLV-1 plasmid, plGagl. DNA extraction and oligonucleotide primers DNA was extracted from whole blood as described by Higuchi et aI (27). The HTLV-1 primers and probes were selected on the basis of their specific- ity for the prototype HTLV- 1 provirus (28), (Table 2). The gag and env primers are the same as those pu- 65  Myhr et al zyxwvusrq able 1 Demographic and clinical data of the patients and the controls including am plification results Amplification of Number of zyxwvutsrqpon ex Course of HTLV- 1 sequences Diagnosis patients (M/F) Agea disease (p/r? (gag, pol and env) MS 155 63192 38.2 241131 0 MSd 28 10/18 44.9 14.14 0 Controls 44 22122 41.5 0 zyxwvuts 8 11/17 44.7 0 10 4/6 4/6 0 20h 1911 34.0 0 ATL 1 li0 34 1 Mean age. p: Primary progressive. r: Primary remitting-relapsing. Patients from the county of Hordaland. Patients from the county of Mere and Romsdal. Patients from the county of Hordaland that were hospitalized for surgical disorders without systemic diseases. Healthy individuals from the county of Mere and Romsdal. Patients with rheumatoid arthritis and connective tissue diseases. Individuals form the county of Hordaland with variable risk for HTLV-1 exposure: healthy seamen who have been in Eastern Asia and the West Indies; patients with different venereal diseases HIV-positive patients. zyxwvutsrqponmlkji plished by Reddy zyxwvutsr t ul 6). The phenylalaninehy- droxylase (PAH) exon 7 primers and probe corre- sponds to the PAH cDNA published by Kwok zyxwvu t nl (29), (Table 2). Polymerase chain reaction Prior to amplification, genomic DNA was heat de- naturated by boiling for 5 niin and quenched on ice. Twenty-five p1 of the DNA samples, equivalent to 1 pg genomic DNA and about 1 5x105 cells, was added to a reaction mixture adjusted to a final concentra- tion of lOmM Tris-HCI, pH 8.3, 50mM KCl, 2.5mM MgCl,, 0.1 Y gelatin, 0.45 ', Nonidet P40, 0.45 ; Tween 20, 0.2mM of each dNTP, 0.4 pM of each the primer oligonuclotides and 2.5 units ofTaq DNA polymerase (Perkin-ElmeriCetus). The reaction vol- ume was adjusted to 100 pl with distilled H,O and subjected to 30 PCR cycles. Each cycle consisted of three parts; 1 min at 94°C for denaturation, 45 s at 55°C for annealing and 45 s at 72°C for extension. The last cycle was followed by extension for 5 min at 72 C. The sensitivity of the PCR was tested in serial dilution experiments which revealed that HTLV- 1 could be detected in reactions with about 1 pg DNA from the HTLV-1 positive patient. In addition dilu- tion series of a plasmid, plGagl, in HTLV-1 nega- tive DNA, revealed that the expected amplification product were seen in reactions with 1 input copy. To ensure that the DNA samples were amplifiable and that components inhibiting the PCR were absent, PAH exon 7 specific primers served as an internal control. The PCR analysis was strictly executed ac- cording to the guidelines for avoiding false positives 30). Electrophoresis and Southern blot hybridization 27 p1 aliquots of amplified DNA was mixed with pl of lox loading buffer, electrophoresed (2 agar- ose gel, stained with ethidium bromide), and trans- ferred to nylon filters (Hybond-N Amersham). The filters were prehybridized in 5x Denhardt solution, 5x SSPE and 59 SDS at 37°C for 1 h and hybrid- ized in 5x Denhardt solution, 5x SSPE, O.l:o SDS and oligonucleotide probes for 6 h at 42°C. The probes were end labelled with P (Amersham), using T4 kinase (Amersham). The stringent wash of the Table 2 Oligonucleotide sequences used for PCR amplification and Southern blot hybridization 0 o m e Function Location Sequence (5 >3 ) HTLV- 1 Pol- 1 Primer( zyxwvutsrqp   2 35 3-2 3 7 4 CAAACCCAAGATCACTTTAAGC Pol-2 Primer(-) 2630-261 1 GAGGCGTTCTGGTTTAAAGG POI-3 Probe(-I 2560-253 1 CTGGCGCCTGTATTGGCAAGATTACAGGCG Gag- 1 Primer( t 863-886 CGACCGCCCCGGGGGCTGGCCGCT Gag-2 Primer(-) 1397-1375 GGTACTGCAGGAGGTCTTGGAGG Gag-3 Probe( t 1102-1 123 GATCCCGTCCCGTCCCGCGCCA Env- 1 Primer( 5685-5708 CTCCCTTCTAGTCGACGCTCCAGG Env-2 Primer(-) 6 152-6 129 GCCACCGGTACCGCTCGGCGGGAG E~v-3 Probe( 5900-5920 GCCTCTCCACTTGGCACGTCC Human PAH exon 7-1 Primer( t (101929-938 (TTCATCCCAG CTTGCACTGG PAH Exon 7-2 Primer(-) (101 1064-1054 (CAGTACTCAC GGTTCGGGGGT PAH exon 7-3 Probe1 t 987-1007 GGGTGGCCTGGCCTTCCGAGT The PAH exon 7-1 primer binds 10 bp upstream of exon 7, and the antisense primer PAH exon 7-2 binds 10 bp downstream of exon 7, as indicated with parentheses The pol gag, env and PAH exon 7 primers yield a 278, 535, 468 and 156 bp amplification product respectively  Lack of HTLV-I-related sequences in MS: W. Norway z ilters was done twice in O.lO,o SDS and zyxwvu x SSC at 46°C for 20 min and then exposed to XAR-5 film (Kodak) at -80°C for 5 h to 7 days. zyxwvu Results Neither the analysis of 183 MS patients nor the analysis of 102 showed the expected amplification products by gel electrophoresis and Southern blot hybridization (Fig 1, lanes 8,9,12,13,16,17). Ampli- fication of the positive controls generated the expected amplification products (Fig 1, lanes 6,7,10,11,14,15). Furthermore, every fourth of the DNA samples were subjected to PCR with the PAH exon 7 primers and all of them yielded a 156 bp amplification product (Fig 1, lanes 2-5). Several sainples were also subjected to PCR analysis using different reaction conditions: 1 pg to 2 pg genoniic DNA as template; 30 s to 1 min for denaturation; 30 s to 2 min for primer annealing; 30 sec to 3 niin for primer extension: 40 C to 68 C as primer annealing temperature; 0.1 pM to 1 O pM primer concentration; 1.0 mM to 2.5 mM MgCl, and 100 pM to 200 pM deoxynucleotide triphos- phate concentration. In addition hot start PCR and low stringence hybridization were done. In spite of these adjustments, no amplification products were detected in samples from the patients or the con- trols. Discussion In Western Norway, long-term epidemiological stud- ies have revealed a significant increase in the inci- dence and prevalence rates of MS in stable popu- lations, indicating the impact of exogenous factors (31-33). In the present study a total number of 183 MS patients and 102 matched controls from this areas were investigated for HTLV-1 related se- quences but no sequences were detected. Recently, Reddy zyxwvutsr t zyxwvuts   using primers from the gag and env genes of HTLV-1 amplified sequences ho- mologous to HTLV-1 in 1000, of the investigated MS patients and in zyxwvutsr   of the controls 6). Green- berg zyxwvutsr r a1 amplified HTLV-1 related sequences in 290; of the MS patients with primers from the pol and iiv regions of the provirus, but not with prim- ers from the LTR or gag regions (34). In other stud- ies, the first reported observations have not been confirmed (5, 7-25). However, some investigators report amplification of HTLV- 1 related sequences in both the MS and the control groups 5, 16, 21-24), but collectively all of these studies report no distinct difference between the groups (5, 16, 21-22), and/or the results were found to be nonpersistent (5,23-24). Recently, Perron et zyxwvut 11 reported isolation of a ret- rovirus antigenically different from any known ret- rovirus from the CSF of 1 of 18 MS patients (35). In addition Haahr er a1 have reported observation of retrovirus-like particles in long-term lymphocyte cul- tures from 2 of 36 MS patients (36). However, epi- demiological data give no support to the hypothesis that HTLV-1 or a closely related retrovirus is a pu- tative factor in MS. The geographic distributions of MS and HTLV-1 are quite different. Areas endemic for E1TLV-1 are mainly South-Western Japan and the Caribbean (37), countries with low prevalence of MS. However, within high prevalence areas for MS, i.e. Northern Europe, including Norway, infections caused by HTLV-1 are rare (38). The results in the present study does not rule out the possibility that a virus or another infectious agent participate in the develpoment of MS, but it strongly suggests that HTLV- 1 or a closely related retrovirus is not involved. Acknowledgements This work was supported by Kjell Alrnes Legacy and the Nor- wegian Society of tnultiple sclerosis. The authors thank William A Haseltine for providing the HTLV-I positive cell line (CYIPL) and the plasniid plcagl), and Mrs Dagny Spissply for excellent technical assttance. References 1. 2. 3. 4 5. 6. 7. 8. 9. 10. 11. COMPSTON SADOVNICK D. Epidemiology and genetics of multiple sclerosis. CONN 1992: 5: 175-81. COOK SD DOWL~NC C. Multiple sclerosis and viruses: n overview. Neurology 1980: 30: 80-91. RICE GPA. Virus-induced demyelination in man: models for multiple sclerosis. CONN 1992: 5: 188-94. KOPROWSK~ . DEFRE~TAS C HARPER ME et al. Mul- tiple sclerosis and human T-cell lymphotropic retroviruses. Nature 1985: 318: 154-60. PRAYOONWIWAT PEASE R, RODR~CUEZ . Human T-cell lymphotropic virus type-I sequences detected by nested polymerase chain reactions are not associated with multiple sclerosis. Mayo Clin Proc 1991: 66: 665-80. REDDY P. SANDBERG-WOLLHEIM . METTUS V, RAY PE DEFREITAS . KOPROWSKI . Amplification and mo- lecular cloning of HTLV-I sequences from DNA of multiple sclerosis patients. Science 1989: 243: 529-33. BANGHAM RM, N~GHTINGALE CRUICKSHANK K. DAENKE . PCR analysis of DNA from multiple sclerosis patients for the presence of HTLV-I. Science 1989: 246: 821. RICHARDSON H. WUCHERPFENNIG W, ENDO N. RUG- DE P. DALGLE~SH G. HAFLER A. PCR analysis of DNA from multiple sclerosis patients for the presence of HTLV-I. Science 1989: 246: 821-3. CHEN SY. HAISLIP M. MYERS W. ELLISON W, MER- RILL JE. Failure to detect human T-cell leukemia virus related sequences in multiple sclerosis blood. Arch Neurol 1990: 47: F~ESCHI BUTTISELLI . ALLECRETTA . SALVETTI , JACOBSON . Multiple sclerosis and HTLV retroviruses. J Neurol 1990: 237: 329-30. JOCWER , RETHW~LM , KAPPOS . TER MEULEN . Search for retroviral sequences in peripheral blood mononu- clear cells and brain tissue of multiple sclerosis patients. J Neurol 1990: 237: 352-5. 1064-5. 67  Myhr et al zyxwvusr 2. zyxwvutsrqponml ISBY G FREDERIKSEN . OLESEN . REITZ MS. Absence of HTLV-I DNA in blood from patients with multiple scle- rosis. Aids Res Hum Retroviruses 1990: 6: 1219. 13. PERL A. NAGY K. PAZMANY et al. No evidence for human T-cell leukemia virus type-I or human T-cell leukemia virus type-I1 infection in patients with multiple sclerosis. Arch Neu- rol 1990: 47: 1061-3. 14. EHRLICH D, GLASER B, BRYZ-GORNIA et al. Multiple sclerosis, retrovirus, and PCR. Neurology 1991: 41: 335-43. 15. FRENCH . MAMMARELLA . CURIA MC et al. Aniplifica- tions of multiple regions of the HTLV-I genome from DNA of Italian spastic paraparesis patient but not from DNA of multiple sclerosis patients. J Neurol Sci 1991: 103: 82-9. 16. KANEKO , SATO . MIYATAKE TSUJI . Absence of highly homologous sequence to HTLV-I in Japanese multiple sclerosis. Neurol 1991: 41: 31-4. 17. ROZENBERG . LEFEBVRE , LUBETZKI et al. Analysis of retroviral sequences in the spinal form of multiple sclerosis. Ann Neurol 1991: 29: 333-6. 18. RUDGE , ALL A, CRUICKSHANK K. Multiple sclerosis, tropical spastic paraparesis and HTLV-I infection in Afro- Caribbean patients in the United Kingdom. J Neurol Neu- rosurg Psychiatry 1991: 54: 689-94. 19. WATTEL . MARIOTTI , BIGNON D et al. No evidence of HTLV-I infection in French patients with multiple sclerosis using the polymerase chain reaction. J Clin Pathol 1991: 44: 871-872. 20. MENZO , MANZIN . BAGNARELLI et al. Lack of detect- able human T-cell lyniphotropic virus type I sequences in samples from multiple sclerosis patients. J Med Virol 1992: 21. CABIRAC F. RIES D, MURRAY KS. Multiple sclerosis, human ‘1-lymphotropic virus type I and human endogenous retrovirus sequences. Ann Neurol 1991: 29: 343-4. 22. DEKABAN A. RICE GPA. Retroviruses and multiple scle- rosis. zyxwvutsrq 1. Failure of gene amplification techniques to detect viral sequences unique to the diseasc. Neurology 1990: 40: 1254-8. 23. FUGGER . MORLING . RYDER LP. SANDBERG- WOLLHEIM , SVEJGAARD . Failure to demonstrate human T cell lyniphotropic virus type I in multiple sclerosis patients. J Gen virol 1990: 7: 1103-7. 24. NAKAYAMA KATAMINE . KANAZAWA et al. Ampli- fication of HTLV-I-sequences among patients with neurologi- cal disorders in highly endemic Nagasaki: lack of evidence for association of HTLV-I with multiple sclerosis. Jpn J Cancer Res 1990: 81: 238-46. 25. OKSENBERG R, MANTECAZZA . SAKAI K. BERNARD CCA. STEINMAN . HTLV-I sequences are not detected in peripheral blood genomic DNA or in brain cDNA of multiple sclerosis patients. Ann Neurol 1990: 28: 574-7. 36: 155-61. 26. BAUER HJ. IMAB Enquete concerning the diagnostic crite- ria for MS. In: Bauer HJ. Poser S, Ritter G, eds. Progress in Multiple Sclerosis Research. Heidelberg, New York: Springer 27. HIGUCHI zyxw   Rapid, efficient DNA extraction for PCR from cells or blood. Perkin Elmer Cetus: Amplifications, a forum for PCR users 1989: 2: 1-3. 2X. SEIKI M. ~IATTORI S. HIRAYAMA . YOSHIDA M. Human adult T-cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA. Proc Natl Acad Sci USA 1983: 80: 3618-22. 29. KWOK S, LEDLEY D DILELLA G, ROBSON KJH, Woo SLC. Nucleotide sequence of a full-length complementary DNA clone and amino acid sequence of human phenylala- nine hydroxylase. Biochetn 1985: 24: 556-6 I. 30. KWOK S, I~IGUCHI . Avoiding false positives with PCR. Nature 1989: 339: 237-8. JP. AARLI A. Incidence of multiple sclerosis in Hordaland, Western Norway: A fluctuating pattern. Neuroepidcmiol 32. MIDGARD . RIISE T NYLAND H. Epidemiologic trends in multiple sclerosis in Mme and Romsdal, Norway: A prevalence/incidence study in a stable population. Neurology 33. MIDGARD . NYLAND . JULSRU OJ. PRESTHUS . RI- ISE T. Local clusters of multiple sclerosis in Western Norway. A prevalence,’incidence study in More and romsdal county. In: Confavreux C, Ainiard G, Devic M. eds. Trends in Eu- ropean niultiple sclerosis research. Amsterdam, New York, Oxford: Elsevier Science Publisher 1988: 74. 34. GREENBERG J. EHRLICH GD. ABBOTT MA. HURWITZ BJ. WALDMANN A. POIESZ J. Detection of sequences homologous to human retroviral DNA in multiple sclerosis by gene amplification. Proc Natl Acad Sci USA 1989: 86: 2878- 82. 35. PERRON . LALANDE . GRATACAP et al. Isolation of retrovirus from patients with multiple sclerosis. Lancet 1991: 337: 862-3. NIELSEN . HANSEN J. Just another dubious virus in cells from a patient with multiple sclerosis. Lancet 1991: 337: 37. SCHULZ TF. WEBER . The biology of the human T-lymphotropic viruses types I and 11 (HTLV-I. HTLV-II), ch 7. In: Dalgleish AG & Weiss RA. eds. Aids and the new viruses. London: Academic Press 1990: 125-62. 38. HAAHEIM R. GRBNNING M, NYLAND . Antibodies in sera from Norwegian multiple sclerosis patients and the gen- eral population reacting with HTLV-I. APMIS 1989: 97: 1980: 555-63. 31. CRBNNlNG M, RIISE T KVALE zyx   NYLAND . LARSEN 1991: 10: 53-61. 1991: 41: XX7-92. 36. HAAHR , SOMMERLUND M. MQLLER-LARSEN A, 863-4. 767-73. 68
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks