Presentations

ANAIS 37ºANCLIVEPA p PDF

Description
O USO DE BIOMARCADORES CARDÍACOS NA PESQUISA POR Dirofilaria immitis E Trypanosoma cruzi EM CÃES SENIS E CARDIOPATAS Letícia Ribeiro CARNEIRO¹*; Arleana do Bom Parto Ferreira de ALMEIDA²; Aline de Jesus
Categories
Published
of 5
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
O USO DE BIOMARCADORES CARDÍACOS NA PESQUISA POR Dirofilaria immitis E Trypanosoma cruzi EM CÃES SENIS E CARDIOPATAS Letícia Ribeiro CARNEIRO¹*; Arleana do Bom Parto Ferreira de ALMEIDA²; Aline de Jesus da SILVA³; Daiane POLETTO 4 ; Ariane da Costa ALVES 4 1. Bolsista de Iniciação Científica, UFMT, Cuiabá, MT; 2. Professor adjunto, Departamento de Clinica Médica Veterinária UFMT, Cuiabá, MT; 3. Graduanda em Medicina Veterinária, UFMT, Cuiabá, MT. 4. Residente do programa uniprofissional em Medicina Veterinária, UFMT, Cuiabá, MT. Resumo O presente estudo teve como propósito estimar a ocorrência de infecção por T. cruzi e D. immitis em cães idosos e cardiopatas em Cuiabá e correlacionar os principais fatores de risco associados à infecção, além de mensurar a presença de lesão cardíaca pelo uso de biomarcador. A Dirofilariose é uma doença parasitária causada pela Dirofilaria immitis e transmitida pelo mosquito Aedes scapularis. A doença possui distribuição cosmopolita e tem como hospedeiro definitivo os canídeos domésticos ocasionando, em casos graves, insuficiência cardíaca congestiva direita. Já a Doença de Chagas é uma antropozoonose causada por Trypanosoma cruzi, transmitida por triatomíneos, tendo o cão como principal reservatório doméstico. Estudos recentes tem demonstrado a utilização de biomarcadores em doenças cardíacas de diversas etiologias, tanto na medicina humana quanto veterinária, com bons resultados. Foram avaliados cães idosos com idade igual ou superior a sete anos e cães com histórico de cardiopatia, independe de raça ou sexo, após prévia autorização dos proprietários. Foram coletadas amostras de sangue, por venopunção jugular, em tubo com anticoagulante para realização do teste de Knott modificado para detectar microfilárias de D. immitis, análise da capa flogística e confecção de esfregaço sanguíneo para visualização de formas tripomastigotas de T. cruzi, além de análise molecular para este agente utilizando os primers D71 e D72. Para análise de lesão cardíaca foi realizada mensuração dos biomarcadores cardíacos CK-Total e CK-MB utilizando kits comerciais segundo fabricante. Não foi possível inferir lesão cardíaca utilizando biomarcador na infecção por D. immitis e T. cruzi, contudo, o aumento dos mesmos nos cães cardiopatas e idosos em comparação aos controles podem auxiliar como método de triagem na suspeita de possíveis alterações cardíacas. Palavras - chave: Cardiopatia, Cão, Biomarcadores. ANAIS 37ºANCLIVEPA p.0440 Keywords: Heart disease, Dog, Biomarkers. Introdução A Dirofilariose é uma doença parasitária conhecida como doença do verme do coração, e transmitida pelo mosquito Aedes scapularis causando lesão cardíaca (BATISTA et al.,2008). É de distribuição cosmopolita e possui relação direta com o desenvolvimento do mosquito, sendo preocupantes em países sub e tropicais, pois tem como hospedeiro definitivo os canídeos domésticos (CIRIO, 2005). Os animais que foram parasitados, após oito meses, apresentam sinais clínicos de cansaço quando submetidos a exercícios físicos, tosse, perda de peso, caquexia, mucosas cianóticas, dispneia, trombocitopenia e insuficiência cardíaca congestiva direita, sendo a gravidade proporcional à carga parasitária, tempo da infecção ou resposta do hospedeiro (BATISTA et al., 2008). A Doença de Chagas é uma antropozoonose parasitária causada por Trypanosoma cruzi, um protozoário cujo ciclo de vida inclui a passagem obrigatória por vários hospedeiros mamíferos, para os quais são transmitidos pelos insetos vetores denominados triatomíneos (ARGOLO et al., 2008). Cuiabá engloba algumas condições que consentem o estabelecimento de diferentes enfermidades, principalmente as de transmissão vetorial, provocado pela existência de um período definido de chuvas, vasta rede fluvial, acentuada degradação ambiental e pouca infraestrutura sanitária (FERNANDES et al., 1999). Sendo assim o projeto teve como objetivo avaliar a infecção por Dirofilaria immitis e Trypanosoma cruzi em cães idosos e/ou cardiopatas, correlacionando os principais sinais clínicos, presença de lesão cardíaca pela mensuração de biomarcardor cardíaco, e possíveis fatores de riscos associados com a infecção na população canina atendida no HOVET-UFMT. Materiais e Métodos Foram avaliados cães idosos com idade igual ou superior a sete anos, provenientes do atendimento clínico do HOVET-UFMT por demanda espontânea, e cães que ao exame clínico inicial apresentaram alterações clínicas condizentes com cardiopatia, independe de raça ou sexo. Para avaliação cardiológica e epidemiológica dos cães, foi feito exame cardiovascular detalhado, como avaliação da circulação periférica, veias sistêmicas, pulso arterial sistêmico, precórdio e auscultação do coração e pulmão visando detectar sinais sutis de cardiopatia. Para análise dos possíveis ANAIS 37ºANCLIVEPA p.0441 fatores de risco associados à infecção por Trypanosoma cruzi e Dirofilaria immitis questões como raça, idade, sexo, local residência, região de origem, histórico de viagens, presença de triatomíneos foram questionados aos proprietários e as informações anotadas em uma ficha individualizada. Para os exames laboratoriais foram coletadas amostras sanguíneas dos animais inseridos na pesquisa por venopunção cefálica ou jugular, sendo uma com e outra sem anticoagulante para obtenção de soro para posterior mensuração de biomarcador cardíaco e pesquisa dos agentes. Para avaliação da presença de lesão cardíaca foi realizada a mensuração sérica dos biomarcadores cardíacos CK total e CK MB utilizando kits comerciais de acordo com recomendação do fabricante (GoldAnalisa ). Na pesquisa de infecção por Dirofilaria immitis foi realizado teste de triagem utilizando a pesquisa de microfilárias circulantes de KNOTT modificada, que consiste em 1 ml de sangue hemolisado em 10 ml de formol a 2%, centrifugado por cinco minutos a 1500 rpm, o sedimento foi misturado com azul de metileno e observado em microscópio óptico a morfologia das microfilárias. Para Trypanosoma cruzi foi realizada pesquisa de formas tripomastigotas em lâmina de esfregaço sanguíneo, análise da capa flogística buscando formas tripomastigotas, e análise molecular pela técnica da Reação em Cadeia pela Polimerase (PCR). Para extração de DNA as amostras de sangue foram processadas de acordo com Sambrook et al. (1989). Sucintamente, cerca de 200µl de sangue foram dissolvidas em tampão de lise contendo 10 mm Tris-HCl, ph 8.0; 10mM EDTA; 0.5% SDS; 0.01% N-laurilsarcozyl e 100 μg/ml de proteinase K, a mistura foi fortemente misturada em vortex e incubada a 56ºC até completa lise celular, por cerca de 12-18h. A extração de DNA foi realizada pelo método fenol/clorofórmio/álcool isoamilico e precipitado por isopropanol. Após lavagem com etanol 70% por 10 minutos a 10,000 x g, o precipitado de DNA foi dissolvido em água ultra pura contendo 20μg/ml de RNAase e estocado a 20ºC. Para detecção molecular foram utilizados primers específicos para T. cruzi D71 (5 AAGGTGCGTCGACAGTGTGG 3 ) e D72 (5 TTTTCAGAATGGCCGAACAGT 3 ). Os produtos amplificados foram analisados em gel de agarose 1,5% corados em gel Red. Resultados e Discussão Entre agosto de 2014 e julho de 2015 foram selecionados 60 animais provenientes do atendimento clínico do HOVET-UFMT, sendo nove cardiopatas, três machos e seis fêmeas com idade entre 5 a 16 anos e das raças Poodle, SRD, Pitbull, Pinscher ANAIS 37ºANCLIVEPA p.0442 e Daschund. Dentre estes, os principais sinais clínicos observados foram tosse e cianose. Dos 51 cães idosos, a idade dos mesmos variou entre sete e 21 anos, com média de 10 anos, sendo 16 machos e 35 fêmeas. As raças dos cães idosos pesquisados foram SRD, Beagle, Poodle, Daschund, Husky Siberiano, Lhasa Apso, Shih-tzu, Dogo Argentino, Akita, Schnauzer, Teckel, Yorkshire. As principais enfermidades apresentadas por estes animais foram tosse, cianose e desmaios. No teste de KNOTT modificado para Dirofilaria Immitis, todos os cães obtiveram resultados negativos, resultando em uma prevalência negativa. Apesar de tal resultado em 1999 obtiveram uma prevalência de 5,8% em Cuiabá (FERNANDES et al., 1999) utilizando a mesma técnica. Aliado a isso, já foi detectado D. immitis em cão em Cuiabá, evidenciando a circulação do agente na capital, apesar da não caracterização da origem do canino em questão. (RAMOS et al., 2015). Para T. cruzi os esfregaços sanguíneos, a análise da capa flogística e a PCR revelaram resultados negativos. Nesta pesquisa, os cães não apresentavam sinais clínicos condizentes com a fase aguda da infecção por T. cruzi, fase em que a sensibilidade de tais testes tende a aumentar. No entanto a ausência de positividade na PCR utilizando primer específico pode confirmar a não infecção por T. cruzi nos cães pesquisados, o teste apresenta uma sensibilidade e especificidade maior que os testes parasitológicos, no entanto, fatores como a técnica empregada, volume da amostra, condições de conservação da amostra, os métodos utilizados para isolar DNA, as sequências de primers selecionados, os reagentes utilizados e as condições de termociclismo podem variar tais características (MULLER et al., 2014). Não foi possível avaliar os biomarcadores cardíacos CK-NAC e CK-MB na infecção por D. immitis e T. cruzi, tendo em vista a não detecção da infecção por estes agentes na população estudada. Não foi observada diferença estatisticamente significativa p = 0,147 entre as médias obtidas para CK-MB entre os três grupos pesquisados pelo teste não paramétrico de Kruskal Wallis e teste de média de Dunn s (p 0,05). Já na análise do CK-NAC obteve-se uma diferença estatistica significativa entre os grupos p = 0,0063 pelo teste não paramétrico de Kruskal- Wallis e diferença entre o grupo controle e idosos pelo teste de médias de Dunn s (p 0,01). Os valores normais de CK determinados em animais domésticos podem variar com atividade física, idade e sexo, entre outros. Porém, para Frederick et al. (2001) CK e CK-MB são pobres marcadores de danos no ANAIS 37ºANCLIVEPA p.0443 miocárdio em cães, sendo a CK-MB um marcador cardíaco menos específico que a troponina cardíaca para esta espécie. Conclusão Conclui-se que tanto T. cruzi e D. immitis possuem baixa prevalência em Cuiabá e devido à baixa demanda de animais, não foi possível afirmar que a cidade está fora de perigo. Em relação à mensuração de substâncias capazes de informar quanto à função miocárdica ainda é relativamente recente na rotina cardiovascular e em medicina veterinária. Por essa razão, a utilidade de testes bioquímicos capazes de detectar e estadear doenças cardíacas são objeto de crescente interesse na prática veterinária. Referências ARGOLO A. M.; FELIX M.; PACHECO R.; COSTA J Doença de Chagas e seus Principais Vetores no Brasil. Imperial Novo Milênio, PIDC, Instituto Oswaldo Cruz, Fundação Oswaldo Cruz, Rio de Janeiro, p BATISTA, N. C.; BEZERRA, N. M.; GADELHA, I. C. N.; BORGES, M. E. O.; CABRAL, S. O.; DIAS, C. E. V.; SAKAMOTO, S. M.; FREITAS, C. I. A, Acta Veterinaria Brasilica, v.2, n.3, p.76-79, CIRIO, S. M. Epidemiologia e clínica de cães portadores de dirofilariose em espaços urbanos de município do litoral do Paraná e aspectos da histologia de Culex quinquefasciatus (Say, 1823) (Diptera, Culicidae) Curitiba. 155p. Tese (Doutorado em Entomologia) Universidade Federal do Paraná. FERNANDES, C.G.N.; MOURA, S. T.; DIAS, A. R.; VIEIRA FILHO, W. S. Ocorrência de dirofilariose canina na região da Grande Cuiabá, estado de Mato Grosso Brasil. Brazilian Journal of Veterinary Research and Animal Science, v.36, n.5, p , FREDERICK, S.; MERTON, G. K.; LERENA, M. J.; HEINING, P..; CARTER, N. D.; HOLT, D. W. Cardiac troponins and creatine kinase content of striated muscle in common laboratory animals. Clinica chimica acta, v. 304, n.1-2, p.65-74, MULLER, C. D.; HOHER, G.; FIGUEREDO, J. B.; CARVALHO, J. F. S.; CAPRARA, J. F.; TRINTINAGLIA, L.; LARA, G. M. Diagnóstico Sorológico em Doença de Chagas com Ênfase na Reação em Cadeia da Polimerase. NewsLab - edição RAMOS, D. G.S.; Zocco, B. K. A.; de Medeiros Torres, M.; Braga, Í. A.; de Campos Pacheco, R.; Sinkoc, A. L. Helminths parasites of stray dogs (Canis lupus familiaris) from Cuiabá, Midwestern of Brazil. Semina: Ciências Agrárias, 36(2), , SAMBROOK J, FRITSCH IFZ, MANIATIS T. Molecular Cloning: a laboractory Manual. 2 ed. New York: Cold Spring Harbor Laboratory Press, Cold Spring Harbon ANAIS 37ºANCLIVEPA p.0444
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks