Homework

Frequency and phylogeny of norovirus in diarrheic children in Istanbul, Turkey

Description
Norovirus (NoV) is recognised as one of the most common causes of foodborne infections. Contaminated shellfish, food, water and hospitals are well documented sources of the virus. NoV in diarrheic children has not previously been investigated in
Categories
Published
of 5
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
   Journalof    ClinicalVirology 51 (2011) 160–164 ContentslistsavailableatScienceDirect  Journal   of    Clinical   Virology  jou   rn   alhomepage:www.elsevier.com/locate/jcv Frequency   and   phylogeny   of    norovirus   in   diarrheic   children   in   Istanbul,   Turkey A.A.   Ozkul a , Bekir   S.Kocazeybek b , Nuri   Turan c , Gábor   Reuter d ,Kamil   Bostan e ,Aysun   Yilmaz f  ,Eda   Altan c ,Gulsah   Uyunmaz c ,Ali   RizaKaraköse b ,Karlo   Muratoglu e ,Murat   Elevli g ,Christopher   R.   Helps h ,Huseyin   Yilmaz c , ∗ a Bas¸kentUniversityHospital,Clinicof    ChildHealthandDiseases,Altunizade,Istanbul,Turkey b UniversityofIstanbul,CerrahpasaMedicalSchool,DepartmentofMicrobiology,Cerrahpasa,Istanbul,Turkey c UniversityofIstanbul,VeterinaryFaculty,DepartmentofVirology,Avcilar,Istanbul,Turkey d RegionalLaboratoryofVirology,NationalReferenceLaboratoryof    GastroentericViruses,ÁNTSZRegionalInstituteofStatePublicHealthService,Pécs,Hungary e UniversityofIstanbul,VeterinaryFaculty,Departmentof    FoodHygieneandTechnology,Avcilar,Istanbul,Turkey f  CevreIndustrialAnalysisLaboratory,MerkezMahallesi,CeylanSokak,No24,MartPlaza,Kat2,Kagıthane,Istanbul,Turkey g HasekiTrainingHospital,ClinicofChild   Health,Haseki,Istanbul,Turkey h UniversityofBristol,SchoolofVeterinarySciences,LangfordHouse,Langford,BristolUK  a   r   t   i   c   le   inf   o  Articlehistory: Received18November2010Receivedinrevisedform9March2011Accepted14March2011 Keywords: NorovirusReal-timeRT-PCR PhylogenyChildrenIstanbulTurkey a   b   s   t   ra   ct Background:   Norovirus(NoV)   is   recognised   asone   of    the   most   commoncausesof    foodborneinfections.Contaminated   shellfish,   food,   water   andhospitals   are   well   documented   sources   of    the   virus. Objective:   NoV   indiarrheic   children   hasnot   previously   been   investigated   in   Istanbul,   Turkey,hence   theaimof    thisstudy   wasto   detectandinvestigatethe   frequency   and   phylogeny   of    human   NoV   genogroupsI   and   IIinchildren   with   acute   gastroenteritis. Study   design: 238   stool   sampleswerecollected   fromdiarrheic   children   from   2hospitals   (Cerrahpasa   Med-ical   Schooland   Haseki)   inIstanbul   andanalysedby   ELISA,   RT-PCR    and   real-timeRT-PCR    using   both   SYBR Green   and   probe-based   assaysfor   human   NoV.   Primerstargeting   the   RNA-polymerase   gene   were   usedfor   RT-PCR    toallowDNA   sequencing   of    Turkish   NoV   strains   and   phylogenetic   analysis   tobe   performed. Results:   NoVGIIwasdetected   in36(15.1%)   of    238   samplesby   SYBRGreen   real-time   RT-PCR,   10.9%   bya   probe-basedreal-timeRT-PCR    and10.5%   by   ELISA   (Ridascreen).   Genogroup   II(GII)the   Turkish   NoVsclusteredwith   including   GII4(72.2%),GII16(5.5%),   GIIb   (16.7%)and   GIIe   (5.5%).Two   variants   of    GII4(GII4-2006bandGII4-2008),GII16andrecombinant   noroviruses   (GIIband   GIIe)were   identified. Conclusion:   This   study   shows   ahigh   frequency   andgenetic   diversityof    NoVGIIinfections   inchildren   withacute   gastroenteritisin   Istanbul,   Turkey. © 2011 Elsevier B.V. All rights reserved. 1.Background Noroviruses(NoV)areclassifiedin   thefamilyof    Caliciviridae .Thegenus Norovirus isdividedintofivegenogroups(I,II,III,IV,andV)basedonphylogeneticanalysis.HumanNoVsbelongto   genogroupsI,II,andIV. 1 Althoughthegenetic/antigenicdiversityof    humanNoVsishigh,genotype4strainsof    genogroupII(GII4)arepre-dominantworldwide.GII.4NoVsevolvedrapidlyandinthelast15yearssixepidemicvariantshavebeenidentified. 2–4 R T-PCRandreal-timeRT-PCRhavebeenusedto   screenfornorovirusesin   fecalsamples,shellfishandotherfoodmatricesbecauseof    theinabilityofnorovirusestoreplicatein   cellculture. 5–8 Norovirusesarerecognisedasa   majorcauseofacutegas-troenteritisworldwideandarefrequentlyassociatedwiththeconsumptionofcontaminatedraworundercookedfood,shellfish ∗ Correspondingauthor.Tel.:+90   2124737070x17069;fax:+90   2124737241. E-mailaddress: hyilmaz@istanbul.edu.tr(H.Yilmaz). andwater.Norovirusis   themostcommoncauseof    food-borneill-nessaccountingfor54%offood-bornediseaseoutbreaksin2006intheUSA. 9 However,thefrequencyandphylogenyof    NoVindiar-rheicchildrenhavenot   previouslybeeninvestigatedinIstanbul,Turkey. 2.Objectives Theaimofthisstudywasto   investigatethefrequencyandphy-logeny(diversityofstrains)ofhumanNoVgenogroupsIandIIinchildrenfromIstanbulwithacutegastroenteritis. 3.Studydesign  3.1.Studypopulationandsampling  Thestudypopulationconsistedof    238children(82femaleand156male)agedasfollows:133were6monthsto5yearsold,73 1386-6532/$–seefrontmatter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2011.03.004   A.A.Ozkulet    al./JournalofClinicalVirology 51 (2011) 160–164 161  Table1 Primersandprobesusedinthisstudy(R=AorG;N=A,C,GorT;   Y    =CorTandW=AorT).AssayTargetPrimersandreferencesSequences(5 ′ –3 ′ )NucleotidepositionProducts(bp) NorovirusGenogroupI  a ORF2regionQNIF4-F 7 CGCTGGATGCGNTTCCAT5291–530885NV1LC-R  7,8 CCTTAGACGCCATCATCATTTAC5376–5354 NorovirusGenogroupIprobe a NV1LCpr 7,8 FAM-TGGACAGGAGAYCGCRATCT-TAMRA5321–5340 NorovirusGenogroupII  b ORF1-ORF2junctionQNIF2d-F 6 ATGTTCAGRTGGATGAGRTTCTCWGA5012–503788COG   2R-R  12 TCG   ACG   CCATCTTCATTCACA5100–5080 NorovirusGenogroupIIprobe b QNIFS 6 FAM-AGCACGTGGGAGGGGATCG-TAMRA5042–5061 NorovirusGenogroupIISequencing  c Polymerase NoroJV12Y-F 13 5-ATACCACTATGATGC   AGAYTA-3 4288–4308326NoroJV13I-R  13 5-TCATCATCACCATAGAAIGAG-34614–4594 a M87661. b AF145896. c AB039732. werebetween6and10yearsoldand32werebetween11and14yearsold.AllchildrenwereadmittedtoClinicsatCerrahpasaMedicalSchoolandHasekiTrainingHospitalinIstanbulwithacutegastroenteritisanddiarrhea.Fecessamplesweretakeneachmonth(3–5samplesweekly)fromApril2008toAugust2009givingatotalof238samples.Sampleswereimmediatelytransportedat4–8 ◦ Candprocessedwithin24h.  3.2.ELISAandsampleprocessingforRNAextraction Thepresenceofnorovirusantigensin   feceswasinvesti-gatedusingacommercialkit(Ridascreen,NorovirusC1401)andperformedasdescribedbythemanufacturer.FecessampleswerepreparedforRNAextractionasdescribedpreviously. 10,11 TheamountofRNAwasmeasuredusingaNanoDropspectrophotome-ter(NanoDrop1000c,Thermoscientific)andfinalconcentrationsadjustedforuseinthereversetranscription.  3.3.   Reversetranscriptionandreal-timePCRusingSYBRGreen Reversetranscription(RT)wasoptimizedandperformedintwostepsasdescribedpreviously. 10 Primersusedforreal-timeRT-PCR(SYBRGreenandprobe-basedassays)andforsequenceanalysisaregiveninTable1andweresynthesizedbyQiagen(Turkey).ThemethodusedfortheSYBRGreenreal-timePCRwasamodificationof    methodsdescribedpreviously. 10,11 Each25  lreal-timePCRreactionmixtureconsistedof    12.5  l   of    HotstarTaq   MasterMix   (Qiagen),0.5  l   of    25mM   MgCl 2  (Qiagen),1  l   Fprimer(10pmol/  l),   1  l   R    primer(10pmol/  l),   0.5  lofSYBR Green(1in1000dilution),4.5  l   nucleasefreewaterand5  lcDNA.Themixturewasplacedin   a   thermalcycler(Biorad,Chromo4)andthepolymeraseactivatedbyincubationat95 ◦ Cfor15min.Themixturewasthencycledat95 ◦ Cfor10sand60 ◦ Cfor15sfor45cycles.Inordertoobtaina   meltingcurve,thethermalcyclerwasprogrammedtoreadthefluorescencefrom60to100 ◦ Cin1 ◦ Cincrementsevery10s.   NegativecontrolsconsistedofRNAextractedfromthefecesof    childrenwithoutdiarrheaandreactionmixturewithnucleasefreewaterinsteadof    cDNA.PositivecontrolsconsistedofcDNAfroma   noroviruspositivefecessampleandplas-mid(diluted1   in   100,000)containingnorovirusGIIandGI.Afterthereal-timePCR,theampliconsofpositivesampleswerevisualizedbyagarosegel   (1.5%)electrophoresis.SamplespositivebytheSYBR Greenassaywerealsoanalysedbyreal-timePCRusinga   specificTaqManprobefornorovirusGIIusingthemethoddescribedabovebutreplacingtheSYBRGreenwith1  l   of    probe(10pmol/  l).  3.4.PCRamplificationandsequenceanalysisofNoVpolymerase gene Allpositivesdetectedbyreal-timeRT-PCR(SYBRGreenorprobe-based)werealsoanalysedbyconventionalRT-PCRtoallowsequenceanalysis.Thiswas   performedasdescribedpreviously. 13 Briefly,a   50  lreactionmixturecontaining8  l   ofcDNA,25  lHot-starTaqMasterMix   (Qiagen),4  l   Fprimer(10pmol/  l),   4  l   R primer(10pmol/  l)and9  l   nucleasefreewater(Qiagen)was   pre-pared.Themixturewasincubated95 ◦ C   for15min;and45cyclesof94 ◦ Cfor60s,37 ◦ Cfor90s,   and74 ◦ C   for60swereperformedAmpliconswereanalysedbyagarosegelelectrophoresisanda326bpproductwasobtainedforpositivesamples.Sequenceanal-ysiswasperformedbya   commercialcompany(REFGEN,Ankara,Turkey).PhylogenetictreesweregeneratedusingMEGA3.1. 4.Results 4.1.ELISA Amongst238fecessamplesanalysed,norovirusantigenwasdetectedin   25(10.5%).ThesesampleswerealsofoundtobepositivebySYBRGreenreal-timeRT-PCR. 4.2.Real-timeRT-PCR Amongstthe238fecessamples,36(15.1%)werefoundtobepositivefornorovirusGIIbytheSYBRGreenassay.GIwasnotdetectedinanyofthefecalsamples.UsingGIIpositivesamplesandpositivecontrols(fecesandplasmid)thereal-timePCRforGII   virusshowedanampliconofabout90bp   onanagarosegel.NoampliconswereseenwhengenogroupIsamplesornegative(water)controlswereused.SerialdilutionsofnorovirusGIIfecesweremadeforoptimiza-tionandincreasingthresholdcyclesvalues( C  T  )wereobserved(Fig.1).The C  T   valueof    undilutedfeceswas   measuredat25.The C  T   valuesofthedilutionswere29at1:10;33at1:100;36.5at1:1000and39.5at1:10,000(Fig.1).The C  T   of1:100,000dilutedplasmidwas   29(Fig.1).ThemeltingtemperatureoftheGIIpositive sampleswas   84 ◦ C.NorovirusGII   was   detectedbySYBRGreenreal-timeRT-PCRinchildrenadmittedto   theclinicsineverymonthbetweenApril2008andAugust2009. C  T   valuesof    allpositivefecessamplestestedrangedfrom13to40.Themeltingtemperatureofthepositivecontrolandpositivesampleswasmeasuredas84 ◦ Cin   allsamples.No C  T   valuewasobtainedwiththeGIprimersetwithnegativecontrolandanytestsample,indicatingtheprobableabsenceof norovirusGI.However,a   C  T   of27was   obtainedwitha   norovirusGIpositivefecescontrolsample,indicatingthat   theassaydiddetectnorovirusGI.Whenthereal-timeRT-PCRwas   performedusingtheTaqManprobespecificfornorovirusGII,26ofthe36SYBR Greenpositivesamplesgavea   signal.The C  T   valueof    8samplesbySYBRGreen(positivebySYBRGreenbutnotdetectedbyprobeassay)wasabove33while2sampleshada   C  T   valueof    below33.Inmostsamples,the C  T   valuesproducedbytheTaqManprobeassaywere1–11cycleshigherthanthoseobtainedusingtheSYBRGreen  162  A.A.Ozkuletal./     JournalofClinicalVirology 51 (2011) 160–164 Fig.1. RealtimePCRSYBRGreenassayof    seriallydilutedpositivestoolusingprimersfornorovirusGII.(1)Undilutedstool;   (2)1:10dilution;(3)   1:100dilu-tion;(4)1:1000dilution;(5)1:10000dilution;(6)negativecontrol;(7)plasmid(1:100000). assay.In5samples,the C  T   valuesoftheTaqManprobeassaywerelowerthanthe C  T   valuesoftheSYBRGreenassay. 4.3.Distributionofpositivesamplesintests TheSYBRGreenassaydetected36samplespositiveforNoVGIIfrom238childrenand26of    thosesampleswerealsodetectedbytheTaqManprobeassay.Twenty-fiveoutof    238childrenwerefoundtobenorovirusantigenpositivebyELISA.Sequenceanalysisrevealedthat   17of    thesamplesdetectedbySYBR Green,ProbeandELISAwereGII.SamplesthatwerenegativebytheSYBRGreenassaywerealsonegativebyELISA.How-ever,theSYBRGreenassaydetected11moresamplesthanELISA(Table2). 4.4.GeneticdiversityofnorovirusesdetectedinTurkey A326bpPCRproductwasobtainedwithbothpositivecon-trolandtestsamples.Thisampliconwasseenbyelectrophoresisin17of238samplesfromchildren.Sampleshaving C  T   valuesabove35usingtheSYBRGreenassaycouldnotbeamplified.Noproductwasobservedin   negativecontrols.The326bpproductwaspurifiedfromthegelandusedforsequencing.Phylogenetictreeswereconstructedfromthenucleotidesequence(Fig.2). ThealignmentindicatedthattheTurkishnoroviruseswereclus-teredwiththeGII,includingGII4(72.2%),GII16(5.5%),GIIb(16.7%)andGIIe(5.5%).Twovariantsof    GII4(GII4-2006bandGII4-2008),GII16andrecombinantnoroviruses(GIIbandGIIe)wereidentified.  Table2 Distributionof    positivityof    humanfecesintests.TestsNumberof positivesSYBRGreenpositive36Probe   positive26ELISA   positive25Sequencing(productseenon   thegel)17SYBRGreenpositive+ELISApositive25SYBR    Greenpositive+ELISAnegative 11SYBRGreennegative+   ELISApositive0SYBRGreenpositive+probepositive+ELISApositive 18SYBRGreenpositive+probepositive+ELISAnegative7 4.5.Demographicfindingsofchildren Theageof    thechildrenfoundtobepositivefornorovirusGIIbyreal-timeRT-PCR(SYBRGreen)rangedbetween1and13years.Themajority(22of36)ofchildrenpositivefornorovirusGIIwerebetween1and3yearsold,withtheremainder(14)between4and13yearsold.Amongstthepositives,24childrenweremaleand12werefemale.Amongstthe17GIIpositivesamplesconfirmedbysequencing,14werefromchildrenagedbetween1and5yearswiththeremaining3fromchildrenagedbetween6and10years.Only3of    the17sampleswerefrommales. 5.Discussion Norovirusesare   recognisedasoneof    themostcommoncausesoffoodandwaterborneinfectionsworldwidecausingoutbreaksof gastroenteritisresultinginover267millioncasesannually. 14 Out-breaksof    humannorovirushavebeenreportedinTurkey 15,16 butthefrequencyofinfectionandstrainscirculatingin   Istanbulhavenotbeeninvestigated.Therefore,theaimofthisstudywastoinves-tigateboththefrequencyandstrainsofnorovirusesinchildrenwithacutegastroenteritisin   Istanbul.ELISA,RT-PCR,real-timeRT-PCRandtransmissionelectronmicroscopy(TEM)havebeenusedinthediagnosisof    humannorovirusinfections,withvaryingsensitivitiesandspecificities. 17 PCRhasbeenfoundto   haveahighersensitivitythanTEMandELISA,whilespecificitywashighestforTEM. 17–21 Variablesen-sitivitiesandspecificitieshavebeenreportedforvariousELISAtests;weusedtheRidascreen-ELISAbecauseof    itsbettersensitiv-itycomparedto   otherEIA-basedtests. 21–23 All   samplescollectedin   thisstudywereanalysedbyELISAandreal-timeRT-PCR(bothSYBRGreenandprobe-basedassays).Duetoviralgenomichet-erogeneityprobe-basedreal-timeRT-PCRassaysmay   failtodetectstrainsthatSYBRGreen-basedRT-PCRassaysdodetect. 5 Thiswasobservedinourstudywithonly26of    36SYBRGreenpositivesamplesgivinga   signalwiththeprobe-basedassayforgenogroupII.Itwas   alsonotedin   thisstudythat   sampleshavingCT   valuesabove35couldnotbeamplifiedforsequencing,althoughsomewerealsopositivebytheprobe-basedassay.Thereasonforthisfindingmaybethelowviralcopynumberinsomeof    thesamplesanalysed.Humannorovirusinfectionsoccurworld-wideandhavebeenwidelyinvestigated.Noroviruswasresponsiblefor45%ofout-breaksinchildreninNorthCarolinabetween2005and2007, 24 2outof7outbreaksinArgentina,in2005–2006, 25 6of    48casesof cruise-relatedgastroenteritisin   Europein   2006, 26 1.8%in2003and11.6%in2006inEurope, 27 78.1%of    stoolsamplesintheNetherlandsfrom1994to2005, 8 36%casesof    outbreaksin   Hungaryfrom1998to2000, 28 about17.7%ofcasesof    diarrheicchildreninNorth-westGermanyin   2004 29 and42%ofoutbreaks(hospitals,nursinghomesandcarefacilities)in   Spainin   2004–2005. 2 InWesternIndia,noroviruspositivityvariedbetween6.3%and12.6%ofstoolsamplescollectedbetween2005and2007. 30 Inmostoutbreakschildren(<5yearsof    age)werefoundto   beatthehighestrisk. 29,31 Inthepresentstudy,themajorityofchildren(22of36)withnorovirusGIIwerebetween1and3yearsold.Asimilaragedistributionwas   alsoseenin   theWesternIndianstudy. 30 InTheNetherlands,twonorovirusgenotypespredominatewithGIIb/Hilversumfoundmainlyinchil-drenbelowtheageof    two-and-a-halfyears,whereasGII.4strainsaffectedallagegroups. 32 Althoughthegenetic/antigenicdiversityof    humannorovirusesis   high,a   fewgenotype4(GII.4)strainsof    genogroupII   arepredominantworldwide.GII.4norovirusevolvedrapidlyinthelast15yearsandvariantshavebeenidentifiedin   Europe(GGII.4-2006b), 3,26 theUK(GII-4v2andGII-4v3), 33 Finland   A.A.Ozkulet    al./JournalofClinicalVirology 51 (2011) 160–164 163 MEGA3.1  Neighbor-Joining method (1000X) Jukes-Cantor CS73   CS127   CS128   CS152   CS85   CS43   CS90   CS123   303445   363140   CS130   CS69   CS138   GII4 (X86557)   GII1 (U07611)   GII12 (AB354299)   CS172   GIIe (AB434770)   GIIa (AB190457)   GIIb (AY682549)   CS117   CS107   CS124   GII2 (X81879)   GII5 (AB020558)   CS11   GII16 (AY682551)   GII3 (U22498)   GII17 (EF529741)   GIId (AB212306)   swineGII11 (AB074893)   swineGII19 (AB126320)   swineGII18 (AY823304)   GII8 (AB039780)   GII15 (AB360387)   GII6 (AB039778)   GII7 (AB039777)   GII9 (AY038599)   GI1 (M87661)   99   99   90   99   70   98   99   69   99   50   98   99   99   100   95   65   50   76   86   98   100   98   59   60   62   0.05   GII4-2008 GII4-2006b GIIe GIIb GII16 GII4 Fig.2. Phylogenetictreegeneratedusingsequencesof    norovirusGIIdetectedinTurkishchildren. (GII.4.-2006b), 34 Spain(GGII.4), 2 Italy(GII.42002,2004,2006a,and2006b) 4 andinBulgaria(GGII.3,GGII.4/2006a,GGII.4/2006b,GGII.20,andGGII.Karachi), 35 a   neighboringcountrytoTurkey.Theresultsof    phylogeneticanalysesof29BulgarianstrainsrevealedGGII.4/2006bto   beresponsiblefortheoutbreak. 35 TheGII.4/2006bstraindetectedinItalyandBulgariawassim-ilartothestraindetectedinthepresentstudyandmayindicatethecirculationof    thisstrainin   thisregionoftheWorld.InTurkeytherewerenoreportsofnorovirusoutbreaksuntil2008,whenonewasidentifiedin   centralAnatoliawith50fecalsamplesfromchildrenandadultsanalysedbyantigen-ELISA(Ridascreen)andRT-PCR.Ofthesamples,26%werefoundtobepositivefornorovirusantigen,while33%werepositivefor
Search
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks