Health & Medicine

Identification and Characterization of Simple Sequence Repeat Markers From Brassica Napus Expressed Sequences

Description
Identification and Characterization of Simple Sequence Repeat Markers From Brassica Napus Expressed Sequences
Published
of 14
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/5790334 Identification and characterization of simplesequence repeat markers for Pythiumaphanidermatum, P...  Article   in  Current Genetics · March 2008 DOI: 10.1007/s00294-007-0167-5 · Source: PubMed CITATIONS 13 READS 57 2 authors , including:Seonghee LeeThe Samuel Roberts Noble Foundation 40   PUBLICATIONS   254   CITATIONS   SEE PROFILE All content following this page was uploaded by Seonghee Lee on 18 December 2013. The user has requested enhancement of the downloaded file. All in-text references underlined in blue are added to the srcinal documentand are linked to publications on ResearchGate, letting you access and read them immediately.  Curr Genet (2008) 53:81–93 DOI 10.1007/s00294-007-0167-5  1 3 RESEARCH ARTICLE Identi W cation and characterization of simple sequence repeat markers for  Pythium aphanidermatum ,  P .  cryptoirregulare , and  P . irregulare  and the potential use in  Pythium  population genetics Seonghee Lee · Gary W. Moorman Received: 22 August 2007 / Revised: 18 November 2007 / Accepted: 20 November 2007/ Published online: 5 December 2007 ©  Springer-Verlag 2007 Abstract Six simple sequence repeat (SSR)-enrichedgenome libraries from Pythium   aphanidermatum, P. irreg-ulare , and P. cryptoirregulare  were constructed to developSSR markers. One hundred six SSR primer pairs for P.aphanidermatum , 73 for P. cryptoirregulare , and 82 for P. irregulare  were initially identi W ed. After examiningprimers, the most polymorphic and reproducible SSRmarkers were selected for each Pythium  species; 14 in P.aphanidermatum , 21 in P. irregulare , and 22 in P.cryptoirregulare . Analysis of isolates from each Pythium species using SSR markers showed the high degree of genediversity and polymorphic information content (PIC) valuein the three species. The average number of alleles was3.5–5.3 in the three Pythium  species. Seven SSR loci from P. cryptoirregulare  and P. irregualre  showed the distinctgenetic separations of P. irregualre  complex isolates. SSRmarkers identi W ed for the three Pythium  target species werehighly transferable to other closely related Pythium  species.Cross-ampli W cation was found in all SSR markers between P. cryptoirregulare  and P. irregulare . SSR loci weresuccessfully ampli W ed by direct PCR from mycelia of  P.aphanidermatum , P. cryptoirregulare , and P. irregulare .These newly developed SSR markers can be used for popu-lation genetic studies and monitoring the movement of isolates in crop production systems or in nature. Keywords Simple sequence repeat · Microsatellites · SSR-enriched genome library · Pythium aphanidermatum  · P. cryptoirregulare  · P. irregulare  · Allele · Diversity · Population genetics Introduction The genus Pythium  (Oomycota) is distributed worldwideand contains more than 200 described species of plant oranimal pathogens, mycoparasites, and aquatic organisms(Dick 1990). Plant pathogenic species of Pythium  havewide host ranges and cause serious damage to economicallyimportant crops. Pythium  species have been traditionallyidenti W ed based on the morphology and size of oogonia,antheridia, and sporangia (Middleton 1943; Plaats-Niterink  1981; Waterhouse 1967). Further work has attempted species identi W cation through molecular methods such asITS (internal transcribed spacer region of ribosomal RNAencoding genes)-RFLP and RAPD analyses (Matsumotoetal. 2000), isozymes (Barr etal. 1997 and 1998), sequences of the ITS region and the mitochondrial cox   IIgene (Garzón etal. 2007; Lévesque and De Cock 2004; Matsumoto etal. 1999; Moorman etal. 2002), restriction patterns of mitochondrial DNA (Martin and Kistler 1990), and ampli W ed fragment length polymorphisms (AFLP) W ngerprinting (Garzón etal. 2005b). There are two Pythium  species, P . irregulare  and P . aphanidermatum , that are found as major pathogens asso-ciated with greenhouse crops in Pennsylvania (Moormanetal. 2002). P. irregulare  is generally isolated more fre-quently than P. aphanidermatum  from plant, soil, and watersamples from greenhouses. A close association of P. aphan-idermatum  with poinsettias has been observed. P. irregulare exhibits high genetic and morphological diversity (Barr 1997) Communicated by D. Ebbole.S. Lee · G. W. Moorman ( & )Department of Plant Pathology, The Pennsylvania State University, University Park, PA 16802-4506, USAe-mail: gmoorman@psu.edu  82Curr Genet (2008) 53:81–93  1 3 and is considered to be a complex of species (Matsumotoetal. 2000). Pythium cryptoirregulare  was recently describedas a new species within the P . irregulare  complex (Garzónetal. 2007). P. irregulare  and P. cryptoirregulare  are verysimilar in morphology, but di V  er signi W cantly in ITS and cox  II gene sequences and AFLP banding patterns.There is a need for molecular methods for populationgenetic studies in these three Pythium  species. Isozyme,RAPD, and AFLP analyses have been applied to examineintraspeci W c variations in P. irregulare  (Barr 1997; Garzónetal. 2005a; Matsumoto etal. 2000). However, the low reproducibility and low polymorphisms revealed by iso-zyme and RAPD markers limit their use. In a previousstudy (Garzón 2004), two AFLP primer combinations werenot able to reveal the genetic variation in geographic ori-gins among P. aphanidermatum  isolates possibly due to ahigh level of clonality or small sample size. To study anorganism that is sexually reproducing, highly polymorphicco-dominant and reproducible molecular markers, such assimple sequence repeats (SSR), may be more appropriatefor population genetic studies.SSR or microsatellite markers have been used in manyorganisms for gene mapping and population genetic studiesbecause they are highly reproducible, are based on co-dom-inant markers inherited in a Mendelian fashion, and areeasy to interpret. SSR regions consisting of short tandemrepeats (one to six nucleotides) are commonly found in pro-karyotic and eukaryotic genomes (Karaoglu etal. 2005). In most genomes of fungi and in Phytophthora , mono-,di-, and trinucleotide repeats are abundant. SSR markersdeveloped in some species of another Oomycetes genus, Phytophthora  have been successfully used for populationgenetic studies (Dobrowolski etal. 2002; Ivors etal. 2006; Lees etal. 2006; Prospero etal. 2007). In this report, we describe the development of SSRmarkers for three Pythium  species, P. aphanidermatum , P.cryptoirregulare , and P. irregulare , using SSR-enrichedgenomic libraries. We examined the informativeness andreliability of resulting SSR markers for the potential use inpopulation genetic studies and tested their transferability toother Pythium  species. Materials and methods Construction of genomic DNA libraries Genomic DNA libraries highly enriched for SSR loci wereconstructed based on the Dynabead biotin-enrichment strat-egy described by Glenn and Schable (2005). Pythium  iso-lates P18 ( P. aphanidermatum ), P50 ( P . cryptoirregulare ),and 63108-98 ( P . irregulare ) were grown on V8 juice brothmedium and DNA was extracted using DNeasy Plant MiniKits (Qiagen, Valencia, CA). Genomic DNA (2   g) of eachisolate was digested separately with the restriction enzymes  Rsa  I and  Alu  I (New England Biolabs, Ipswich, MA) at37°C for 3h. After verifying successful digestion andlinker ligation by electrophoresis in a 1.5% agarose gel, twodigest/ligation DNAs (  Rsa  I or  Alu  I) for each isolate werecombined. To perform Dynabead enrichment for the micro-satellite-containing DNA fragments, linker-ligated DNAwas incubated with each mixture of 3   biotinylated micro-satellite probes, (AG) 12 (AC) 12 (CT) 12 (GT) 12  and (AAC) 6 (GGT) 6 (AAG) 8 . Streptavidin M-280 Dynabeads (Invitro-gen, Carlsbad, CA) were washed twice with TE (10mMTris pH8.2, 2mM EDTA) and twice with 1 £ Hyb solution(6 £ SSC, 0.1% SDS). The DNA of each Pythium  isolateand probe mixture was incubated with the washed Dynabe-ads at room temperature for 1h. The beads captured usingthe Dynal MPC ® -S (Invitrogen, Carlsbad, CA) were rinsedfour times with the washing solution (2 £ SSC, 0.1%SDS). Then, beads were washed two more times (1 £ SSC,0.1% SDS) and heated for 5min at 5 to 10°C below the T m for the oligonucleotide mix used. The enriched fragmentswere isolated by incubating beads in TLE (10mM Tris,0.1mM EDTA, pH 8.0) at 95°C for 10min. PCR ampli W- cations using the linker (superSNX-24) were ligated into acloning vector, pCR2.1-TOPO, as directed by the manufac-turer (Invitrogen, Carlsbad, CA). Transformed  E. coli  cells(chemically competent TOP10 cells, Invitrogen) wereplated on Luria-Bertani (LB) agar (10g tryptone, 5g yeastextract, 5g NaCl, and agar 15g/l) containing ampicillin(50   g/ml) and X-gal (50   g/ml) and grown overnight at37°C. Positive colonies (white) were transferred into wellsof a sterilized deep well plate (96 wells) containing LBbroth with ampicillin and were incubated 40h at 37°C withmoderate shaking.Identi W cation of SSR loci To examine for the presence of an insert in each plasmid,bacterial transformants were screened by PCR ampli W cationwith M13 primers (M13-F: GTAAAACGACGGCCAG,M13-R: CAGGAAACAGCTATGAC) before sequencing.PCR products were puri W ed using the ExoSAP method (12)and sequenced using primers M13 forward and reverse at theNucleic Acid Facility of The Pennsylvania State University.To determine SSRs in clone sequences, the sequence assem-bly and analysis software, Staden package working with themodule and tandem repeat occurrence locator (TROLL), wasused (Castelo etal. 2002; Martins etal. 2006). SSR primer design and screeningSSR primers (n=261) were designed from X anking regionsof dinucleotide and trinucleotide repeats using the Primer3  Curr Genet (2008) 53:81–93 83  1 3 release 1.0.0 (Rozen and Skaletsky 2000) and IntegratedDNA Technologies PrimerQuest (IDT, Coralville, IA).Primers were designed to be 18 to 24 nucleotides in length,have a melting temperature (T m ) of 58°C, amplify productsof 100 to 400bp in size, have a GC content of 50%, andlack secondary structure. All primers were synthesized byIntegrated DNA Technologies (Coralville, IA) and wereinitially screened on four randomly selected isolates fromeach of P. aphanidermatum , P. cryptoirregulare , and P.irregulare . PCR ampli W cations were performed in a20   l total mixture of 50ng of DNA, 2   l of 10 £ standard Taq  reaction bu V  er (New England Biolabs, Ipswich, MA),0.5   l of 10mM dNTP mix (Promega, Madison, WI.),0.2   l of Taq  DNA polymerase (New England Biolabs,Ipswich, MA), 2   l of each primer (stock concentration;3   M) with the following PCR program; 94°C for 3min, 30cycles of 94°C for 1min, 55°C for 1min, and 72°C for1min, and a W nal extension at 72°C for 10min followed bya holding temperature of 4°C. PCR products were separatedin 1.5% agarose gels to determine the banding pattern of ampli W ed products. Those primers that produced fragmentsof the expected sizes were subsequently used to screen anadditional eight randomly selected isolates of each of thethree target Pythium  species. PCR products were separatedin 6% polyacrylamide gels run in 0.5 £ Tris-borate-EDTA(TBE) bu V  er (50mM Tris, 50mM boric acid, 1mMEDTA, pH 8.3) at 350v constant power for 1.5h with ahigh-throughput sequencing gel system (C.B.S Scienti W cCompany, Inc., Del Mar, CA). Gels were stained with ethi-dium bromide (0.5   g/ml). DNA fragments were visualizedwith UV light and photographed.SSR allele determinationThe most polymorphic SSR markers, four for P. aphanid-ermatum , three for P. irregulare , and four for P. cryptoir-regulare , from the screening of twelve isolates for each of the target Pythium  species were selected to determine thenumber and sizes of alleles. The variability of the SSR lociwas evaluated using 30–40 isolates of each Pythium  spe-cies that were identi W ed by the ITS region sequence. PCRampli W cation was performed as follows; 2min of initialdenaturation at 94°C followed by 30–35 cycles of 94°C for30s, annealing temperatures for 30s (Table1), 72°Cfor 30s, and a W nal extension 10min at 72°C. The totalnumber of alleles at each SSR locus was determined byelectrophoresis (6% polyacrylamide gel). The isolatescontaining di V  erent allele sizes were ampli W ed with theSSR primer 5   labeled with X uorochrome FAM (6-car-boxy- X uorescein) (Integrated DNA Technologies, Coral-ville, IA). The size of individual PCR products (1   l) ateach SSR locus was determined using an automatic ABIprism 3730 XL capillary sequencing system (Penn StateUniversity, Nucleic Acid Facility) and analyzed usingGeneMapper ®  software Version 4.0 (Applied Biosystems,Foster city, CA.). To con W rm that the di V  erent allele sizesresulted from polymorphisms in the SSR region ratherthan insertions/deletions in the sequences X anking therepeat, the polymorphic alleles of each SSR locus wasextracted from the 6% polyacrylamide gel, and puri W edusing GenElute PCR Clean-Up Kit (Sigma-Aldrich,St.Louis, MO), and sequenced using an ABI Hitachi3730XL DNA analyzer (Penn State University, NucleicAcid Facility). Sequences of alleles of each SSR locuswere aligned and compared using the sequence alignmentprogram, MultAlin (Corpet 1988). SSR marker data analysisHighly polymorphic and reproducible SSR markers, sixfor P. aphanidermatum , six for P. cryptoirregulare , andfour for P. irregulare , were tested for their informative-ness and reliability for further genetic studies. DNA fromisolates of P. aphanidermatum  ( n =40), P. cryptoirregu-lare  ( n =40), and P. irregulare  ( n =30) from di V  erenthosts and locations (Table2) were ampli W ed in a 96-wellPCR microplate with conditions as described above. Theobserved (  H  O ) and expected heterozygosity (  H  E ) at eachSSR locus was determined using POPGENE version 1.32(Yeh and Boyle 1997). The degree of polymorphism was estimated by polymorphism information content (PIC)values and gene diversity for individual polymorphic SSRloci were estimated using PowerMarker version 3.25 (Liuand Muse 2005). Phylogenetic reconstruction for P. cryp-toirregulare  and P. irregulare  isolates ( n =70) with sevenSSR loci was performed based on neighbor-joiningmethod with shared allele distance (D AS ) implemented inPowerMarker.Cross-species ampli W cation of SSR markers Two to three isolates of each of 22 Pythium  species, thathad been previously identi W ed based on ITS regionsequences, were used to determine the transferability of SSR markers to other related Pythium  species: P. aphanid-ermatum , P. cryptoirregulare , P. irregulare, P. arrhenom-anes , P. cylindrosporum , P. deliense , P. dissotocum , P.graminicola , P. helicoides , P. heterothallicum , P. inter-medium , P. middletonii , P. myriotylum , P. pyrilobum , P.rostratum, P. segnitium , P. spinosum , P. splendens , P.sylvaticum , P. torulosum , P. ultimum , and P. vexans .The 57 SSR primers were examined for two to threeisolates of each Pythium  species. The PCR products wereseparated on 2% agarose and 6% polyacrylamide gels.The degrees of polymorphisms of each Pythium  species werenot evaluated because of the small number of tested isolates.  84Curr Genet (2008) 53:81–93  1 3 Table1 Loci, primer sequences, repeat motifs, annealing temperatures, and fragment sizes of polymorphic SSR loci for Pythiumaphanidermatum , P. cryptoirregulare , and P. irregulare LocusRepeat motifPrimer sequences (5   to 3  )T a  /PCR cyclesSize (bp) P. irregulare 63108GGTGTC1-54(GGTGTC) 3 (GGTGTT) 5 (GGTGTT) 4 F: CTGACGATGCTGATGGTGTCR: TGGTAAACCAACACCGACACTGAC60°C/3011363108ACA1-67(ACA) 7 F: GGGTCTTGATTGGGGACAR: CTAGTGGTTGAGTCGAGTGCC56°C/3013063108CAA2-41(CAA) 10 F: TTAATGAAGTGCAAGGTGATCGR: GTACCGTTCTCTCAAGGTTGCT55°C/3018963108CAC2-56(CAC) 8 F: GAAGCGAAGCAGATTGTGCAATGGR: AGTACTGGCGATGGGACCATCATT60°C/3029563108CAA3-11(CAA) 10 F: AATTCTGGTGCTTCTTCCATGTR: GTACCGTTCTCTCAAGGTTGCT56°C/3016663108TTC3-79(TTC) 10 F: CAGCACCTTCAACGCCCTGATR: ATCGGCGATTGACCAGTTAGAGCA60°C/3013463108TGGTGT4-9(TGGTGT) 6 C(TGGTGT) 7 F: GATGCTGATGGTGTTGGTGTR: CTCAGCCGACGTTGGTAAAC56°C/3013863108TTC4-15(TTC) 9 F: CTCGAACGAAGTCGGCAAATCTCTCAR: ACAAGTGGAGTAAGT TCGACGCCA60°C/3016863108TG1-3(TG) 15 F: CAAGACAAGGCGCAGCAAGACAAAR: ACACCTACCACCCACACACACAAT60°C/3018963108GA1-11(GT) 7 (GA) 16 F: GAGAGAAGGAAGCAGACTACTCGTR: ACACAATGATGCGCACATCGACAC60°C/3021763108CT1-54(CT) 15 F: ATCAGGAAGTGCGGTATGAACGGAR: AGACGAAGAAGAATGGGTGCGGAT60°C/3024463108AC1-71(AC) 17 F: TGACGCAGGAGAGCAACGCTAAATR: TGCTCAGGACGGAGATCCATGAAA60°C/3024163108AC2-23(AC) 16 F: ATAAACACCACCTTACGT TGCGCCR: CAAGACAAGGCGCAGCAAGACAAA60°C/3016763108AG2-33(AG) 15 F: GCTTCTAGCACCGGACTGATTTCCATR: GGGTGCCAAGAGCATTTCAATCCA60°C/3221463108GA2-47(GT) 9 (GA) 12 F: ATCACTACGAGATCCTCGGCATCGR: AAGTATGCGGTCTCTAATGGCAGC60°C/3212763108GA2-53(GA) 21 F: AGGACAACAGTCACGCTATCAGR: CCCTCTGCCTCGAAACATATAC56°C/3010363108TC2-72(TC) 15 F: TTGCTCATTTCTGGATCTGCTCGGR: GTAGTCGCCATGGTCGCTTATTGA59°C/3012263108GA3-71(GA) 18 F: GCTTCATTTCCATCCCTGAR: TACTCGACAGAGAGTGTGGGTT55°C/3010563108AG3-77(AG) 16 A(GA) 5 F: ATCCTAATCTGGCAACTGGAGCACR: TCAAACCGGAAGACTCGATAGGCA59°C/3018863108CT3-81(CT) 19 F: TTGCACTTGTGGGAGATGAGTGGAR: TGAAGTGATCCCAGCCGCGTATTA60°C/3014063108AG3-90(AG) 28 F: ATACGCTGGCGATAGATAGAGCR: GGGGAGGGAGATCAGGAA56°C/30115 P. cryptoirregulare P50CTT1-79(CTT) 8 F: ACTTTGGACGGTGACAACATACGCR: ACGTAGCGGTGGTAGAGAGAATGA59°C/30137P50TTG1-80(TTG) 10 F: CCTCCCACTGGAGAAGCTTGR: TCGTCAACAATAACAACGACAA55°C/30128P50TTC2-51(TTC) 10 F: TCAATCAGCACCTTCAACGCCCTR: ATCGGCGATTGACCAGTTAGAGCA60°C/30106P50GAA3-36(GAA) 8 F: TGGTTTCCAGAGCAGATACAAAR: CACCTATTCCAGTTGGTTGGTC55°C/30199
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks