Lifestyle

Recessive mutations in PTHR1 cause contrasting skeletal dysplasias in Eiken and Blomstrand syndromes

Description
Recessive mutations in PTHR1 cause contrasting skeletal dysplasias in Eiken and Blomstrand syndromes
Categories
Published
of 5
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Recessive mutations in  PTHR1  cause contrastingskeletal dysplasias in Eiken and Blomstrandsyndromes Sabine Duchatelet 1 , Elsebet Ostergaard 2 , Dina Cortes 3 , Arnaud Lemainque 4 and Ce´ cile Julier 1, * 1 Genetics of Infectious and Autoimmune Diseases, Pasteur Institute, INSERM E102, 28 rue du docteur Roux, 75724Paris Cedex 15, France,  2 Department of Medical Genetics, The John F. Kennedy Institute, Gl. Landevej 7, 2600Glostrup, Denmark,  3 Department of Pediatrics, Glostrup University Hospital, Ndr. Ringvej 57, 2600 Glostrup, Denmarkand  4 Centre National de Ge´notypage, 2 rue Gaston Cre´mieux, CP 5721, 91057 Evry Cedex, France Received September 25, 2004; Revised and Accepted October 20, 2004 Eiken syndrome is a rare autosomal recessive skeletal dysplasia. We identified a truncation mutation in theC-terminal cytoplasmic tail of the parathyroid hormone (PTH)/PTH-related peptide (PTHrP) type 1 receptor( PTHR1 ) gene as the cause of this syndrome. Eiken syndrome differs from Jansen and Blomstrand chondro-dysplasia and from enchondromatosis, which are all syndromes caused by  PTHR1  mutations. Notably, theskeletal features are opposite to those in Blomstrand chondrodysplasia, which is caused by inactivatingrecessive mutations in  PTHR1 . To our knowledge, this is the first description of opposite manifestationsresulting from distinct recessive mutations in the same gene. INTRODUCTION Eiken syndrome is a rare familial skeletal dysplasia which has been described in a unique consanguineous family, where itsegregates as a recessive trait (1). It is characterized bymultiple epiphyseal dysplasia, with extremely retarded ossifi-cation, principally of the epiphyses, pelvis, hands and feet, aswell as by abnormal modeling of the bones in hands and feet,abnormal persistence of cartilage in the pelvis and mild growth retardation (1). On the basis of the genetic study of this srcinal family, we report here that a truncation mutationin the C-terminal tail of the parathyroid hormone (PTH)/PTH-related peptide (PTHrP) type 1 receptor (  PTHR1 ) gene isresponsible for this syndrome. RESULTS We have studied the family originally described by Eiken,from which six individuals were available (Fig. 1). In additionto Eiken syndrome, one of the patients developed type 1 dia- betes at 9 years of age. The association of multiple epiphysealdysplasia and insulin-dependent diabetes in this case would strictly classify her as having Wolcott–Rallison syndrome(WRS) (2), although the later age at onset, the absence of asystematic association of skeletal dysplasia and diabetes inthis family and the unique clinical features, particularly inthe pelvis, hands and feet, make it clearly distinct. Bylinkage analysis and mutation screening, we excluded theimplication of the pancreatic eIF2 a  kinase gene (  EIF2AK3 ),which is responsible for WRS (3, 4), in this patient (data notshown).Despite the limited size of this family (five informativeindividuals), the maximum expected LOD score, assumingfull genetic information in the region of linkage, would reach a value of 3.3. We therefore performed a genome-wide scan using 400 microsatellite markers, and identified asingle region of linkage, located on chromosome 3p, with amaximum multilocus LOD score of 3.2 (Fig. 1). As expected,the region of linkage is broad,   50 cM, between markersD3S2338 and D3S1285. This region may contain in theorder of 500 genes, and mutation screening of all these geneswould not be practical. Using Mapviewer interface (http://www.ncbi.nlm.nih.gov/mapview), we found one gene in thisregion that has been previously implicated in some forms of chondrodysplasias: the  PTHR1  gene; this is a G protein-coupled receptor, which is involved in the regulation of chondro-cyte proliferation and differentiation and plays a major role in bone development (5, 6). We therefore considered this geneas a good candidate for Eiken syndrome. We screened thetotality of the coding region of the gene in two heterozygous  Human Molecular Genetics, Vol. 14, No. 1 # Oxford University Press 2005; all rights reserved  *To whom correspondence should be addressed. Tel:  þ 33 140613701; Fax:  þ 33 145688929; Email: cjulier@pasteur.fr   Human Molecular Genetics, 2005, Vol. 14, No. 1  1–5  doi:10.1093/hmg/ddi001 Advance Access published on November 3, 2004   b  y g u e  s  t   on N o v e m b  e r 1  7  ,2  0 1  3 h  t   t   p :  /   /  h m g . oxf   or  d  j   o ur n a l   s  . or  g /  D o wnl   o a  d  e  d f  r  om   individuals (individuals 5 and 6) and their homozygousaffected child (individual 1) and identified a C . T substi-tution in the last exon, resulting in a nonsense mutationARG485STOP (Fig. 2A). We confirmed the cosegregationof this mutation in the homozygous status with Eiken syn-drome in this family, both by sequencing (data not shown)and by a PCR–RFLP assay (Fig. 2B). Using the same assay,we confirmed the absence of this mutation in 160 Caucasiancontrols. The mutation is located in the C-terminal cyto- plasmic tail of the protein, resulting in a variant truncated of its last 108 amino acids. This domain contains a cluster of serine residues which are phosphorylated upon ligand  binding; it is able to bind to several proteins, including G protein receptor kinases and   b -arrestin, and has been shownto be involved in the desensitization/internalization processof the receptor and in its regulation (5). DISCUSSION Mutations in  PTHR1  have been reported in two types of skeletal dysplasias: metaphyseal dysplasia in Jansen chondro-dysplasia, a dominant disorder resulting from constitutivelyactivating mutations (7), and osteosclerosis and advanced skeletal maturation in Blomstrand chondrodysplasia, a reces-sive lethal disorder resulting from inactivating mutations (8).A mutation in  PTHR1  has also been reported in enchondroma-tosis, a dominant disorder characterized by multiple cartilagetumors, frequently associated with skeletal deformity (9). Inaddition,  PTHR1  knock-out mice exhibit a phenotype similar to Blomstrand syndrome (10). In contrast to Blomstrand chon-drodysplasia patients, patients with Eiken syndrome have aseverely delayed skeletal maturation, although both disordersare caused by recessive mutations in PTHR1. The phenotypein Eiken syndrome is more similar to Jansen chondrodyspla-sia, although the syndromes clearly differ by the mode of inheritance, specific skeletal features and calcium and phos- phate concentrations; calcium and phosphate levels werefound to be within normal range in Eiken patients (1), whileJansen patients have severe hypercalcemia and hypophospha-temia (6). In addition, the serum PTH level was found to beslightly elevated in Eiken patient 3, while it was normal in Figure 2.  PTHR1 gene mutation screening and identification. ( A ) Sequence of two heterozygous parents (individuals 5 and 6) and one homozygous child (individual 1), showing a C . T substitution at position 1656 on the cDNA(GenBank: accession no. NM_000316), which results in an ARG485STOPnonsense mutation in the C-terminal tail of the protein. ( B ) Mutation genotyp-ing by PCR–RFLP assay, showing co-segregation of the mutation with thedisease in the family. Figure 1.  Eiken syndrome family and linkage analysis. Individuals shown in black are affected by Eiken syndrome. Individual 3 is affected by type 1 dia- betes, in addition to Eiken syndrome. Segregating haplotypes in the region of linkage are shown. Undetermined genotypes are shown as ‘0’. The region boxed is found in the homozygous status in all affected individuals. 2  Human Molecular Genetics, 2005, Vol. 14, No. 1   b  y g u e  s  t   on N o v e m b  e r 1  7  ,2  0 1  3 h  t   t   p :  /   /  h m g . oxf   or  d  j   o ur n a l   s  . or  g /  D o wnl   o a  d  e  d f  r  om    patients with Jansen syndrome (6). Circulating levels of 1,25-(OH) 2 VitD were normal in the Eiken patient, while thelevels were found to be elevated in patients with Jansen syn-drome (6). To our knowledge, this is the first description of opposite manifestations resulting from distinct recessivemutations in the same gene.PTHR1 activates several signal transduction pathways,including adenyl cyclase (AC)/protein kinase A (PKA) and  phospholipase C (PLC)/protein kinase C (PKC). Recentstudies have shown opposite effects of these two pathwayson chondrocyte differentiation, the former increasing the pro-liferation of chondrocytes and delaying their differentiation,opposite to the effect of the latter (6). This was evidenced ina knock-in mouse model expressing solely a mutant form of PTHR1 (DSEL) modified in the second intracellular loop,that activates AC/PKA normally, but not PLC/PKC; thismouse shows a recessive phenotype with delayed ossification, particularly marked in the tail, metatarsal and digital bones,expansion of columnar proliferating chondrocytes and normal calcium and phosphate levels (11). Despite the differ-ent nature and location of the mutations, these abnormalitiesare remarkably similar to the distinctive features observed inEiken patients, who also have delayed ossification, principallyof the hands and feet, abnormal development of some cartilageareas and normal calcium and phosphate levels.Extended   in vitro  studies have been performed on PTHR1variants carrying truncations in the C-terminal cytoplasmictail. PTHR1 variants truncated at positions 480 and 513showed a marked increase of the AC/PKA signaling activity, particularly for the 480STOP variant, while the PLC/PKCactivity was unaltered (12). In addition, these truncated var-iants showed decreased expression, so that the net effectmay be an unchanged AC/PKA activity and a decreased PLC/PKC activity  in vitro  (12), leading to similar overall con-sequences as the DSEL variant (13). We therefore propose thatthe expected unbalanced AC/PKA versus PLC/PKC activitycaused by the Eiken mutation is responsible for a phenotypesimilar to the DSEL mouse. Alternatively, or in addition, part of the biological functions that are mediated by PTHR1and altered in Eiken syndrome may occur in the cytoplasmor the nucleus, where PTHR1 has also been localized, and for which there is increasing evidence for a role in mediating biological effects (5,14). The C-terminal tail of PTHR1 islikely to be involved in these functions, because of its rolein the receptor conformation, in the stabilization of some protein complexes and because of the presence of a predicted nuclear localization signal at positions 471–487 (15), which isdisrupted in the ARG485STOP mutant.One of the four Eiken syndrome patients (individual 3)developed type 1 diabetes at 9 years of age. This patient pre-sented GAD autoantibodies at onset of diabetes, and had thehigh risk HLA (DRB1  03/DRB1  04) and insulin (INS-23HphI A/A) genotypes. The diabetes in Eiken syndrometherefore differs from that in typical WRS, which manifestsearly, usually before 6 months of age, is not autoimmuneand is systematically associated with the specific epiphysealdysplasia in patients with  EIF2AK3  mutations (4). Interest-ingly, PTHrP has been shown to mediate pancreatic  b -cellgrowth (5), and we hypothesize that the PTHR1 mutation inEiken syndrome may be responsible for a reduced   b -cellmass, which may increase the risk of diabetes in genetically predisposed individuals.Despite the extreme rarity of Eiken syndrome (a smallunique family), we were able to characterize the molecular defect underlying it. This is the fourth disease associated with mutations in the  PTHR1  gene, and our observation pro-vides further insight into the multiple functions mediated bythis receptor, which has important therapeutic potentials for many diseases, including osteoporosis and diabetes. MATERIALS AND METHODS Patients and family We studied the family srcinally reported by Eiken  et al.  (1).Six individuals were available for study, four of whom wereaffected with this syndrome (Fig. 1). Individuals 1 and 4 belong to the srcinal sibship of three affected childrendescribed in this previous report (cases 3 and 1, respectively),where they were still in childhood. Individual 2 was anaffected cousin. A previous child from this couple (individuals1 and 2), affected with the same syndrome, died earlier and samples were not available for study. Adult patients’ heightwas slightly decreased (153.5 and 154 cm for individuals 1and 2, respectively), as was their child (individual 3) at 10years of age (130.2 cm,  2 1 SD). In the srcinal article, allstandard biochemical analyses were normal in all the patientsexamined, including calcium and phosphate levels. In additionto these, serum PTH level was measured in child 3 and found to be slightly elevated (63 ng/l; normal range: 10–50 ng/l);1,25-(OH) 2 VitD was normal in this patient. In addition toEiken syndrome, individual 3 developed type 1 diabetes,with onset at 9 years of age. GAD autoantibodies were posi-tive at onset of the diabetes. She was treated by subcutaneousinsulin injections. All individuals participating in this studygave their informed consent. Microsatellite genotyping Genome scan was performed by semi-automated fluorescentgenotyping, using 400 microsatellite markers (LinkageMapping Set 2, Applied Biosystems), as described (http://www.cng.fr/fr/teams/microsatellite/index.html). Mutation screening by sequencing of genomic DNA Mutation screening was performed on genomic DNA from anaffected individual (individual 1) and his unaffected parents(individuals 5 and 6) using primers shown in Table 1.Sequencing reactions were performed using big-dye termin-ator chemistry using standard protocols and run on anApplied Biosystems Sequencer ABI3700. PCR–RFLP genotyping of the mutation The region containing the mutation was first amplified fromgenomic DNA with primers used for sequencing (fragment24, Table 1); a nested PCR was then performed with primers 5 0 -cactggcactggacttcacg-3 0 and 5 0 -gtggcagtgggcagtagg-3 0 . The forward primer includes a mismatched base in  Human Molecular Genetics, 2005, Vol. 14, No. 1  3   b  y g u e  s  t   on N o v e m b  e r 1  7  ,2  0 1  3 h  t   t   p :  /   /  h m g . oxf   or  d  j   o ur n a l   s  . or  g /  D o wnl   o a  d  e  d f  r  om   order to create an artificial discriminative  Bsa AI restrictionsite. PCR fragments were then digested with  Bsa AI, yieldingfragments of 148 bp (non-mutated allele) or 129  þ  19 bp(mutated allele), which were resolved by agarose gelelectrophoresis. Linkage analyses Parametric multilocus linkage analysis was performed usingSIMWALK program (16). ACKNOWLEDGEMENTS We thank Dr Lise Lykke Thomsen for initial follow-up of thefamily. S.D. was a recipient of a Ministery of Research PhDtraining Grant. This work was supported in part by grantsfrom the Pasteur Institute, INSERM and a JDRF/INSERM/FRM grant to C.J. REFERENCES 1. Eiken, M., Prag, J., Petersen, K. and Kaufmann, H. (1984) A newfamilial skeletal dysplasia with severely retarded ossification and abnormal modeling of bones especially of the epiphyses, the hands, and feet.  Eur. J. Pediatr. ,  141 , 231–235.2. Wolcott, C.D. and Rallison, M.V. (1972) Infancy-onset diabetes mellitusand multiple epiphyseal dysplasia.  J. Pediatr. ,  80 , 292–297.3. Dele´pine, M., Nicolino, M., Barrett, T., Golamaully, M., Lathrop, G.M.and Julier, C. (2000) EIF2AK3, encoding translation initiation factor 2-alpha kinase 3, is mutated in patients with Wolcott–Rallisonsyndrome.  Nat. Genet. ,  25 , 406–409.4. Sene´e, V., Vattem, K.M., Dele´pine, M., Rainbow, L.A., Haton, C.,Lecoq, A., Shaw, N.J., Robert, J.J., Rooman, R., Diatloff-Zito, C.  et al. (2004) Wolcott–Rallison syndrome: clinical, genetic, and functionalstudy of EIF2AK3 mutations and suggestion of genetic heterogeneity.  Diabetes ,  53 , 1876–1883.5. Clemens, T.L., Cormier, S., Eichinger, A., Endlich, K., Fiaschi-Taesch, N., Fischer, E., Friedman, P.A., Karaplis, A.C., Massfelder, T., Rossert, J. et al.  (2001) Parathyroid hormone-related protein and its receptors:nuclear functions and roles in the renal and cardiovascular systems,the placental trophoblasts and the pancreatic islets.  Br. J. Pharmacol. , 134 , 1113–1136.6. Schipani, E. and Provot, S. (2003) PTHrP, PTH, and the PTH/PTHrPreceptor in endochondral bone development.  Birth Defects Res. Part C: Embryo Today ,  69 , 352–362.7. Schipani, E., Kruse, K. and Juppner, H. (1995) A constitutively activemutant PTH–PTHrP receptor in Jansen-type metaphysealchondrodysplasia.  Science ,  268 , 98–100.8. Jobert, A.S., Zhang, P., Couvineau, A., Bonaventure, J., Roume, J.,Le Merrer, M. and Silve, C. (1998) Absence of functionalreceptors for parathyroid hormone and parathyroid hormone-related peptide in Blomstrand chondrodysplasia.  J. Clin. Invest. ,  102 ,34–40.9. Hopyan, S., Gokgoz, N., Poon, R., Gensure, R.C., Yu, C., Cole, W.G.,Bell, R.S., Juppner, H., Andrulis, I.L., Wunder, J.S.  et al.  (2002) Amutant PTH/PTHrP type I receptor in enchondromatosis.  Nat. Genet. , 30 , 306–310.10. Lanske, B., Karaplis, A.C., Lee, K., Luz, A., Vortkamp, A., Pirro, A.,Karperien, M., Defize, L.H., Ho, C., Mulligan, R.C.  et al.  (1996)PTH/PTHrP receptor in early development and Indian hedgehog-regulated bone growth.  Science ,  273 , 663–666.11. Guo, J., Chung, U.I., Kondo, H., Bringhurst, F.R. and Kronenberg, H.M. (2002) The PTH/PTHrP receptor can delaychondrocyte hypertrophy  in vivo  without activating phospholipaseC.  Dev. Cell  ,  3 , 183–194.12. Iida-Klein, A., Guo, J., Xie, L.Y., Juppner, H., Potts, J.T., Jr,Kronenberg, H.M., Bringhurst, F.R., Abou-Samra, A.B. and Segre, G.V. (1995) Truncation of the carboxyl-terminal region of therat parathyroid hormone (PTH)/PTH-related peptide receptor enhancesPTH stimulation of adenylyl cyclase but not phospholipase C.  J. Biol.Chem. ,  270 , 8458–8465. Table 1.  Sequencing primers, size and position of the fragmentsPCR fragmentAmplification/sequencing primers Size of PCR  product (bp)Internal sequencing primers Position onAC109583Forward Reverse1  ctgaggagacacccttctgg agcagacctgggagtctgaa  566 121770–1223352  cccaaagggtttatgggtct gagagttcccctgtgctctg  556 122066–1224503  cagggatccacaggtcaaag agcacattccagctgtagcc  563 122450–1230124  gcctgcctccctgactaact atctgactccttgcccactg  564 122832–1233955  gctcgttctacagacccacag cacgtgtgtgtgcctcaata  521 123223–1237436  gggctgtgttcatacctcgt atagcacggcccaggtattt  586 123611–1241967  cgtcccaaggaggctacata ccaaccctcagtgcaaatct  773 126380–1271598  aatacatggggaatgcacct gaccctcgacttaggggaag  617 127034–1276509  gtaccgggaggtggtaggtt gcgacgctgtcagtccac  584 127508–12809110  cctagggccgagaggaac gagtgtggagaggccgagag  504 127911–12841411  ccgtgctttccagaagagaat ctgacaccgagacagagcag  595 128226–12882012  ggtatcccgagagctccat cagccacactgagccctta  593 128598–12919013  gacaggcagaccgacagag gaggggactctcacccaaag  997  agtgtggctgcaaagttgag  129014–13001014  catagagcagattccccaca tctgggcctcttcagttgat  550 140003–14055215  cctcacccatcgtctcagat gtagccctgggtccactctt  543 141830–14237216  gagcagagagaaaggcgaga cactgaacccctagctccaa  856 143426–14428117  ggaatgggaccacatcctg gatgagcacagctacggtga  588 144123–14471018  caaccttaccctggcctctt tgaggtaggagccttgatgg  799  ggcagaggggtactcacgta  144545–145343 atcttcgtcaaggacgctgt 19  gcatccccctgagagagc ctgaatcttggcctgatggt  585 145399–14598320  gagtgtggctctgtcaccaa ttgaggcattagctcccatc  530 147126–14765521  acttccaaagaggcctgtga cccggacgatattgatgaag  550 147502–14805122  gaccagctgatccacactcc cactcaccgcctacctgttc  566 147860–14842523  aacgggccctattagcactt cagaatgtcctcaggggtgt  582 148592–14917324  cctgtagccaaacaccctgt gatttccacatgggtccact  920  ccactatgtcagcaggtcca  149356–150275 agaccctcgagaccacacc 4  Human Molecular Genetics, 2005, Vol. 14, No. 1   b  y g u e  s  t   on N o v e m b  e r 1  7  ,2  0 1  3 h  t   t   p :  /   /  h m g . oxf   or  d  j   o ur n a l   s  . or  g /  D o wnl   o a  d  e  d f  r  om   13. Iida-Klein, A., Guo, J., Takemura, M., Drake, M.T., Potts, J.T., Jr,Abou-Samra, A., Bringhurst, F.R. and Segre, G.V. (1997) Mutations inthe second cytoplasmic loop of the rat parathyroid hormone (PTH)/PTH-related protein receptor result in selective loss of PTH-stimulated  phospholipase C activity.  J. Biol. Chem. ,  272 , 6882–6889.14. Maioli, E. and Fortino, V. (2004) The complexity of parathyroid hormone-related protein signalling.  Cell Mol. Life Sci. ,  61 , 257–262.15. Watson, P.H., Fraher, L.J., Hendy, G.N., Chung, U.I., Kisiel, M., Natale, B.V. and Hodsman, A.B. (2000) Nuclear localization of thetype 1 PTH/PTHrP receptor in rat tissues.  J. Bone Miner. Res. ,  15 ,1033–1044.16. Sobel, E. and Lange, K. (1996) Descent graphs in pedigree analysis:applications to haplotyping, location scores, and marker-sharing statistics.  Am. J. Hum. Genet. ,  58 , 1323–1337.  Human Molecular Genetics, 2005, Vol. 14, No. 1  5    b  y g u e  s  t   on N o v e m b  e r 1  7  ,2  0 1  3 h  t   t   p :  /   /  h m g . oxf   or  d  j   o ur n a l   s  . or  g /  D o wnl   o a  d  e  d f  r  om 
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks