Letters

Bovine piroplasms in Minorca (Balearic Islands, Spain): a comparison of PCR-based and light microscopy detection

Description
Bovine piroplasms in Minorca (Balearic Islands, Spain): a comparison of PCR-based and light microscopy detection
Categories
Published
of 12
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  See discussions, stats, and author profiles for this publication at:https://www.researchgate.net/publication/11843303 Bovine piroplasms in Minorca(Balearic Islands, Spain): Acomparison of PCR-based andlight microscopy detection  ARTICLE   in  VETERINARY PARASITOLOGY · SEPTEMBER 2001 Impact Factor: 2.46 · DOI: 10.1016/S0304-4017(01)00464-2 · Source: PubMed CITATIONS 108 READS 111 6 AUTHORS , INCLUDING:Sonia AlmeríaAutonomous University of Barc… 117   PUBLICATIONS   2,173   CITATIONS   SEE PROFILE Agustin Estrada-PeñaUniversity of Zaragoza 209   PUBLICATIONS   4,642   CITATIONS   SEE PROFILE Available from: Sonia AlmeríaRetrieved on: 05 February 2016  Veterinary Parasitology 99 (2001) 249–259 Short communication Bovine piroplasms in Minorca (Balearic Islands,Spain): a comparison of PCR-based and lightmicroscopy detection S. Almeria a , ∗ , J. Castellà a , D. Ferrer a , A. Ortuño a ,A. Estrada-Peña b , J.F. Gutiérrez a a Parasitology, Faculty Veterinary Medicine, Autonomous University of Barcelona, Barcelona, Spain b Parasitology, Faculty Veterinary Medicine, University of Zaragoza, Zaragoza, Spain Received 16 January 2001; accepted 20 April 2001 Abstract The present study provides the first epidemiological data regarding infection by  Theileria  and  Babesia piroplasmsincattleinMinorca.Morethan94%ofthestudiedanimalswerepositiveforthepresence of   Theileria  sp., and of those, 41.3% were positive for the presence of   Theileria annulata .TheseresultsindicatethattheprevalenceofMediterraneantheileriosiscausedby T.annulata isveryhighinMinorcandairyfarmsandthatother Theileria sp.arealsopresentinthearea.Theprevalenceof infection was similar throughout the study indicating an endemic situation in this island. Theuse of PCR resulted in significantly higher efficacy of detection of   Theileria  sp. compared tomicroscopical observation (MO) of blood smears and allowed the specific discrimination betweenpathogenic and non-pathogenic theilerias which cannot be accomplished by traditional diagnosisby MO.  Babesia  infection in the area was mainly due to  Babesia bigemina  (6.0% of the studiedanimals were infected), while one animal (0.75%) was found to be infected by  Babesia bovis .It was observed that 31% of animals infected with  B. bigemina  had a concurrent infection of   T.annulata.  PCR also resulted in a significantly higher efficacy of detection of   Babesia  sp. comparedto MO when infection levels were higher, towards the end of the study period .  The results clearlydemonstratethatparasiticinfectionbypiroplasms,especially Theileria sp.iscommonandendemicin the island of Minorca and that PCR is the optimal approach for the detection and discriminationof these important parasites. © 2001 Elsevier Science B.V. All rights reserved. Keywords:  Piroplasms; Cattle; Protozoa; PCR;  Theileria  sp.;  Theileria annulata ;  Babesia bigemina ;  Babesiabovis ∗ Corresponding author. Tel.: + 34-93-581-2847; fax: + 34-93-581-2006.  E-mail address:  sonia.almeria@uab.es (S. Almeria).0304-4017/01/$ – see front matter © 2001 Elsevier Science B.V. All rights reserved.PII: S0304-4017(01)00464-2  250  S. Almeria et al./Veterinary Parasitology 99 (2001) 249–259 1. Introduction MinorcaisasmallBalearicisland(702km 2 )locatedintheMediterraneansea(39 ◦ 52 ′ 30 ′′ N;4 ◦ 20 ′ 00 ′′ E).TheweatherisofamaritimetemperateMediterraneantypewithameanannualtemperature of 17 ◦ C, mean annual rainfall of 654mm and high relative humidity (average72%). On Minorca, animal husbandry is a very important economical resource. There are19,000, mainly dairy, cattle distributed in 1200 small farms with typically 30–60 animalsperfarm.Milkproductionreaches40 × 10 6 lperyearandismainlyusedforcheeseproduc-tion ( > 3 × 10 6 kg cheese per year). Tick parasitism is favored by the environmental con-ditions, the intensive husbandry and the strong genetic selection pressure on animals forhigher milk production.  Rhipicephalus bursa ,  Hyalomma marginatum ,  Hyalomma lusitan-icum ,  Boophilus annulatus ,  Rhipicephalus turanicus  and  Haemaphysalis punctata  have allbeen observed on the island (Castellà, 2000). For many years, clinical cases of a cattlesickness associated with tick infestation, locally known as “yellow disease”, have been ob-served. However, no epidemiological studies to ascertain diagnosis have been carried outon the island to date. Theileria annulata , a tick-borne protozoan parasite, is the causative agent of tropicaltheileriosis. This disease, also called Mediterranean theileriosis in the Mediterranean basin,is one of the most fatal types of theileriosis in Europe, North Africa and Asia (Dolan,1989; Sparagano, 1999). The disease affects cattle, and to a lesser extent water buffalo,and acts as a major constraint on livestock  (Tait and Hall, 1990).  Hyalomma  ticks arethe main vector of   T. annulata  (Robinson, 1982). If the animal recovers from infection, along-lastingcarrierstatusoccursinwhichlownumbersoferythrocytesremaininfectedwith Theileria  piroplasms (Neitz, 1957, Urquhart et al., 1996). These carrier animals have animportant role in the transmission of the infection by the  Hyalomma  ticks (d’Oliveira et al.,1995). It is known that other species of   Theileria  of low pathogenicity or avirulent exist(Uilenberg,1981)whichunderfieldconditionsneedtobedistinguishedfromthepathogenic T. annulata .Bovinebabesiosis,causedbythetick-transmitedprotozoan  Babesiabigemina and  Babesiabovis , is considered one of the most frequent and important tick-borne diseases of cattleworldwideandresponsibleforimportanteconomiclosses(McCosker,1981).Both  Babesia species share  Boophilus  sp. as the main vector, although transmission may occur by othertick species (Papadopoulos et al., 1996a). As in Mediterranean theileriosis, animals thatsurvive  B. bigemina  and  B. bovis  infections become low-level carriers of the parasites andserve as reservoirs for further transmission.Although the case history, clinical signs and lesions can indicate clinical theileriosis orbabesiosis, a definitive diagnosis can only be achieved by laboratory methods. Laboratorydiagnosis is usually based on the light microscopy detection of the parasite in thin smearsof blood and on the presence of macroschizonts of   Theileria  in Giemsa-stained lymph nodebiopsy smears (Uilenberg, 1981). However, microscopic detection of piroplasms samplesfrom carrier cattle is not always easy because low numbers of parasites lead to a highfalse negative diagnosis. Another problem is that differentiation of piroplasm species basedsolelyonmorphologyisdifficult,andconfusionmayariseifmixedinfectionsoccur.Indeed,although disease outbreaks associated with only one hemoparasite species are consideredimportantbythemselves,itisoftenthecasethatseveralspeciesarefoundtogetherunderfield  S. Almeria et al./Veterinary Parasitology 99 (2001) 249–259  251 conditions (d’Oliveira et al., 1995). Serological tests, such as the indirect immunofluores-cenceantibodytest(IFAT)alsohavedisadvantages.Theantibodiesoftencannotbedetectedin long-term carriers despite the presence of piroplasms, and furthermore, cross-reactivitywith antibodies directed against other species limits IFAT specificity (Burridge et al., 1974;Kiltz et al., 1986; Papadopoulos et al., 1996b).The advent of the polymerase chain reaction (PCR) has allowed the development of sensitive and specific diagnostic assays for the detection of numerous pathogenic agents,includingseveral Theileria and  Babesia species,incarrieranimals(Lewetal.,1997;Calderet al., 1996; d’Oliveira et al., 1995; Figueroa et al., 1992, 1993; Tanaka et al., 1993; Bishopetal.,1992;Fahrimaletal.,1992).PCRtechniquesallowthedetectionofpiroplasmsatlowparasitaemias, discrimination among  Babesia  and  Theileria  species, and discrimination of  T. annulata  from other non-pathogenic  Theileria  species.This study provides the first epidemiological data regarding infection by  Theileria  sp., T. annulata ,  Babesia bigemina  and  B. bovis  in cattle from Minorca. PCR analysis wasperformed with DNA isolated from blood samples obtained from cattle exposed to ticks infield conditions. The diagnostic sensitivity of PCR was compared to conventional detectionin blood smears by light microscopy (MO). 2. Materials and methods 2.1. Animals and samples A total of 133 adult cattle exposed to tick infection in field conditions were sampled overthree seasons depending on farm size. In all, 45 animals were sampled in March, 40 in Juneand 48 in October. Each farm was sampled once, with the exception of three selected farmsthat were sampled in each season (March, June and October) to follow up on the infectionprogress. Blood samples were collected in EDTA. Thin blood smears were prepared andstainedbyQuick-panoptic(QCA,Spain)andthepresenceofpiroplasmswasassessedunderlight microscopy. Ticks were collected from the sampled animals and identified accordingto Gil Collado et al. (1979). 2.2. DNA isolation and PCR reactions DNA was isolated from 200  l of blood. After lysis of red blood cells, samples wereincubated with proteinase K (200  g/ml) at 56 ◦ C for 1h. Afterwards, proteinase K was in-activatedat95 ◦ Cfor10min.Sampleswerethenextractedwithphenol–chloroform–isoamylalcohol(25:24:1),followedbyasecondextractionwithchloroform–isoamylalcohol(24:1).DNA was precipitated with 100% ethanol, washed once with 70% ethanol and resuspendedin50  lofTris–EDTA(TE)beforebeingusedastemplateforPCR.Positivecontrolsamplesfor  T. annulata  and  Theileria  sp. were kindly provided by Dr. Habela (Faculty of VeterinaryMedicine of Cáceres, Spain) and by Dr. Garc´ıa-Fernández and colleagues (CIFA, Granada,Spain). A positive control for  Babesia bovis  was kindly provided by Dr Jongejan (Utrech,The Netherlands) and a positive control for  Babesia bigemina  was obtained from a clini-cal case diagnosed at our laboratory. Negative control samples included blood DNA from  252  S. Almeria et al./Veterinary Parasitology 99 (2001) 249–259 Table 1Description of primers of   Theileria annulata ,  Theileria  sp.,  Babesia bigemina  and  Babesia bovis  used in the studyand size of their amplified productsParasite Primers Sequence (5 ′ –3 ′ ) Product size (bp) Theileria annulata  N516 a GTAACCTTTAAAAACGT 721N517 a GTTACGAACATGGGTTT Theileria  sp. 989 a AGTTTCTGACCTATCAG 1098990 a TTGCCTTAAACTTCCTTG  Babesia bigemina  (1) b CATCTAATTTCTCTCCATACCCCTCC 278(1) b CCTCGGCTTCAACTCTGATGCCAAAG  Babesia bovis  (2) c GGGTTTATATAGTCGGTTTTGT 711(2) c ACCATTCTGGTACTATATGC a As described by d’Oliveira et al. (1995). b (1) As described by Figueroa et al. (1992). c (2) As described by Fahrimal et al. (1992). healthycattlewithoutcontactwithticks;watercontrolforDNAcontaminationandcontrolsfor the absence of PCR contaminants by performing PCR without DNA.The size of the amplified products and the primer sequences are listed in Table 1. PCRreactions were performed as previously described by d’Oliveira et al. (1995) for  Theileria sp. and  T. annulata ; Figueroa et al. (1992) for  B. bigemina  and Fahrimal et al. (1992) for  B. bovis  with minor modifications. After setting up the optimal conditions for each parasiteamplification(Fig.1showsthesetupfor T.annulata PCR),thePCRreactionwascarriedout Fig. 1. Set up of PCR conditions for  Theileria annulata . Three concentrations of MgCl 2  were analyzed (line 1:0.5mM MgCl 2 , line 2: 1.5mM MgCl 2  and line 3: 2.5mM MgCl 2 ). After selecting 1.5mM MgCl 2  (line 2) as theadequate concentration, number of cycles (30 and 35 cycles) and Taq polymerase concentrations (2.0, 2.5 and3.0U) were analyzed in duplicated samples (a and a ′ : 2.0U; b and b ′ : 2.5U; c and c ′ : 3.0U).  M  : molecular weightstandard (  X 174 RF DNA/   Hae  III). The figure shows that the optimal conditions for  T. annulata  amplificationwere provided by 1.5mM MgCl 2  and 3.0U Taq polymerase during 35 cycles.
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x