Entertainment & Humor

Molecular basis for the rhino Yurlovo (hrrhY) phenotype: severe skin abnormalities and female reproductive defects associated with an insertion in the hairless gene

Description
In 1989, mice bearing mutations at the hr (hairless) locus were first proposed as a model for the human hair growth disorder papular atrichia, since in both these mice and in corresponding patients, a complete hair loss develops due to disintegration
Published
of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Exp Dermatol 1998: 7: 281–288 Copyright  C  Munksgaard 1998Printed in Denmark  ¡  All rights reserved ISSN 0906-6705 Molecular basis for the rhino Yurlovo ( hr rhY  )phenotype: severe skin abnormalities andfemale reproductive defects associated with aninsertion in the hairless gene Panteleyev AA, Ahmad W, Malashenko AM, Ignatieva EL, Paus R,  A. A. Panteleyev 1 , W. Ahmad 1 , Sundberg JP, Christiano AM. Molecular basis for the rhino Yurlovo  A. M. Malashenko 3 , ( hr rhY  ) phenotype: severe skin abnormalities and female reproductive de- E. L. Ignatieva 3 , R. Paus 4 , fects associated with an insertion in the hairless gene. J. P. Sundberg 5 and Exp Dermatol 1998: 7: 281–288. C Munksgaard, 1998 A. M. Christiano 1,2 Departments of  1 Dermatology and  2 Genetics & Abstract: In 1989, mice bearing mutations at the  hr  (hairless) locus were Development, Columbia University, New York, first proposed as a model for the human hair growth disorder papular NY;  3 Laboratory of Experimental Biological atrichia, since in both these mice and in corresponding patients, a com- Models, Russian Academy of Medical Sciences, plete hair loss develops due to disintegration of the normal follicle structure Yurlovo, Moscow District, Russia;  4 Department into dermal cysts and so-called utriculi. Recently, the human hairless gene  of Dermatology, Charite´, Humboldt University, was characterized, and pathogenetic mutations were found to be associ-  Berlin, Germany;  5 The Jackson Laboratory, Bar ated with a recessively inherited form atrichia with papular lesions; how-  Harbor, ME, USA ever, the functions of   hr  gene remain unclear. Allelic mutations in themurine hairless gene represent a potentially powerful tool to elucidate therole of the hairless gene protein product in hair follicle physiology. In1980, several naked animals were discovered in a breeding colony of B10.R109/Y mice maintained in the Laboratory of Experimental Bio-logical Models (L.E.B.M., Yurlovo, Moscow District, Russia). By crossbreeding with hairless HRS/J  hr/hr  mice, this mutation was shown to beallelic with hairless. Here, we describe the molecular basis of the  hr rhY  Key words: hair follicle – hairless gene – mutation in mice, which consists of a 13 bp insertion in exon 16 of the  atrichia – ovulation hr  gene. Histological evaluation of Yurlovo mouse skin revealed some dif- Angela M. Christiano, Department of ferences as compared to the hairless and rhino mutations, with the for-  Dermatology, Columbia University, College of mation of dermal megacysts being the most specific peculiarity of the  Physicians & Surgeons, 630 West 168th Street, Yurlovo mutation. These results, together with previous studies of   hr rhY  /  VC 15–1526, New York, NY 10032, USATel.: 212 305–9565. Fax: 212 305–7391 hr rhY  mutant mice, suggest that the rhino Yurlovo ( hr rhY  ) mutation repre- e-mail: amc65 / columbia.edu sents a third and potentially more severe variation of the hairless pheno-type.  Accepted for publication 28 July 1998 Introduction Recently, the human hairless ( hr ) gene was clonedand characterized, and pathogenetic mutationswere found to be associated with a recessively in-herited complete loss of body hairs with papules(1, 2), known as papular atrichia (3). This dis-covery was the first time a single putative regula-tory gene was identified in which mutations are di-rectly responsible for a non-inflammatory alo-pecia-like disorder in humans. The human, mouse,and rat hairless genes encode a putative single zinc- 281 finger transcription factor (4, 5). In mice, muta-tions in the hairless gene result in complete hairloss during entry into the first hair cycle (6, 7),immunological abnormalities and extreme suscep-tibility to lymphomas (8, 9), elevated susceptibilityof mice to UV and chemically induced tumorogen-esis (10–12), and to dioxin toxic action upon skin(13, 14). In 1989, hairless mice were first proposedas a mouse model for human papular atrichia (15).In addition to the obvious role of   hr  in hair folliclephysiology (1, 7, 16), we believe it is likely that  hr gene mutations may cause similar pleiotropic ef-  Panteleyev et al. fects in humans, supporting the clinical relevanceof more extensive studies into  hr  physiology.Nevertheless, although the structure of the  hr  genein human and rodents is already described, thefunctions of the corresponding protein remainlargely unknown.The value of laboratory mouse models in com-parative studies of gene function in humans cannotbe overestimated. The creation of knock-out andtransgenic mice to investigate the functional rolesof different genes in tissue and cellular homeostasishas provided crucial insights in this respect. Simi-larly, the numerous naturally occurring mutationsin mice leading to the knock-out of functionalgenes and specific clinical symptoms are a usefuland readily available model for studies of differentinherited diseases in humans (17), providing thatthe molecular basis of these mouse mutations issufficiently well-characterized. Therefore, the dif-ferent spontaneous allelic mutations in the murinehairless gene that result in suppression of its activ-ity are powerful tools to elucidate the function of the hairless gene. Several mouse alleles of hairlessare known: hairless ( hr ), rhino ( hr rhJ  ,  hr rh7J  ,  hr rh8J  ,and  hr rh9J  ), bald ( hr ba ), near naked ( Hrn ), trans-genic  hr TgN5053Mm ( hr tg1 ), Yurlovo ( hr rhY  ) (18–24),but only the  hr  (22) and  hr rh8J  (24) alleles of hair-less have been characterized at the molecular level.In 1980, several mice lacking hair were discover-ed in a breeding colony of B10.R109/Y mice main- Figure 1.  Rhino Yurlovo ( hr rhY  ) mutant mice at the age of 4.5 (a) and 6.5 (b) months compared to 4.5-month-old HRS/J hairless( hr ) (c) and RHJ/LeJ rhino ( hr rhJ  ) (d) mutants. Note the more extensive skin mass and folding in Yurlovo mutants. 282 tained in the Laboratory of Experimental Biologi-cal Models (L.E.B.M., Yurlovo, Moscow District,Russia). The mode of inheritance of this pheno-type confirmed that it was caused by an autosomalrecessive mutation. Homozygous mutant micewere characterized by complete hair loss during 3–5 weeks after birth with consequent extensive skinthickening and folding while heterozygous animalsremained apparently normal (21). The patterns of hair loss, gross appearance of homozygous mutantanimals, and histological findings typified by disin-tegration of hair follicles and formation of cysticstructures in the dermis, suggested a similarity tothe rhino and hairless phenotypes described earlierin laboratory mice of a different genetic back-ground (21, 25). The mating of heterozygous mu-tant females with homozygous hairless HRS/J  hr/ hr  males resulted in approximately equal amountsof naked and normally haired offspring, thus con-firming that this mutation is allelic to hairless.However, some specific peculiarities of the newmutant line suggested that this mutation was notcompletely identical to rhino or hairless pheno-types. Therefore, it was previously designatedrhino Yurlovo ( hr rhY  ) (21). The rhino Yurlovomutation is now maintained in the L.E.B.M. onthe C57BL/10SnY genetic background as a smallbreeding stock.Here, we describe the molecular basis of   hr rhY  mutation in mice and some histological peculiari-  Molecular basis for the rhino Yurlovo ( hr rhY   ) mutation in mice ties of mutant mouse skin. Together with previousstudies of   hr rhY   /hr rhY  mutants, the results of thisanalysis suggest that the rhino Yurlovo mutationrepresents a third, and potentially more severe,variation of the hairless phenotype, in addition to hr  and  hr rh . Materials and methods Animals, tissue collection and nucleic acidsisolation Three homozygous ( hr rhY  / hr rhY  ) (Fig. 1a, b) and 3heterozygous ( π / hr rhY  ) C57BL/10SnY mice (4 fe-malesand2malesfrom2littersattheageof4.5and6.5months)wereobtainedfromthebreedingcolonymaintained in the Laboratory of Experimental Bio-logical Models (Moscow District, Russia). For pre-liminary morphological comparison, skin samplesfrom age-matched HRS/J hr/hr hairless ( hr ), RHJ/ Figure 2 . Mutation analysis in C57BL/10SnY  hr rhY  / hr rhY  ,  π / hr rhY  , and  π / π  mice demonstrates the segregation of the mutation withrhino Yurlovo phenotype. Direct sequencing of intron 16 of the hairless gene revealed the homozygous 13 bp insertion in mutantmice (A) compared to wild type allele (C).  π / hr rhY  animals possess this mutation in the heterozygous form (B). 283 LeJ hr rhJ /hr rhJ rhino ( hr rhJ  ) and C57BL/10SnJ  π / π wild type mice were used (Jackson Laboratory, BarHarbor, ME, USA). The animals were euthanizedby CO 2  asphyxiation. Skin and liver were collectedfor histology and nucleic acid isolation. Skinsamples were harvested from the upper back andimmediately frozen in liquid nitrogen, and stored at ª 80 æ C. Additional sections were fixed in buffered4% paraformaldehyde and then processed for rou-tine histology (H&E). Freshly obtained liversamples were homogenized and processed for gen-omic DNAisolation using Puregene DNA isolationKit (Gentra Systems, Minneapolis, MN, USA) ac-cording tothe manufacturer’sprotocol. Frozenskinsamples were homogenized with a Bessman TissuePulverizer (Fisher, Pittsburgh, PA, USA) and sub- jected to total RNA extraction using TRIzol Re-agent (Gibco BRL, Gaithersburg, MD, USA) fol-lowing the manufacturer’s recommendations.  Panteleyev et al. Polymerase chain reaction and DNA sequencing PCR amplification of a 0.93 kb genomic DNAfragment encompassing exons 13–16 of the mousehairless gene was carried out using primers placedat nucleotides 3135–3154 and 3549–3568 in thecDNA sequence (GenBank accession numberZ32675). The forward primer was: 5 ø CGTCCA-AAGTTAGATGAGGG3 ø  and the reverse primerwas: 5 ø ATCTGGAGAAAGCGACGGAT3 ø . Fiftyng/ml of each primer was used to amplify 100 ngof genomic DNA with Platinum Taq DNA Poly-merase (Gibco BRL, Gaithersburg, MD, USA).For PCR in an OmniGene thermal cycler (MarshScientific, Rochester, NY, USA), standard cyclingconditions were used: 1 min at 94 æ C, 1 min at 60 æ Cand 1 min at 72 æ C for 35 cycles. All PCR reactionsbegan with an initial denaturation step for 4 minat 94 æ C. The PCR products were purified withHigh Pure PCR product purification Kit (Boehr-inger Mannheim) and sequenced on both strandsusing ABI Prism 310 Genetic Analyzer (AppliedBiosystems, Foster City, CA, USA). To confirm themutation, sequencing with a new forward primerplaced at nucleotides 3369–3390 (GenBank ac-cession number Z32675) 5 ø AATCTATGCGTG-GAGGTGTCTG3 ø  was performed and gave thesame result. Results and Discussion Molecular analysis of a hairless gene mutation inhr rhY   /hr rhY  mice In search of the underlying mutation, the genomicDNA fragment encompassing exons 13–16 of the hr  gene in homozygous ( hr rhY  / hr rhY  ), heterozygous( π / hr rhY  ), and wild type ( π / π ) C57BL/10 SnYmice was sequenced (Fig. 2). Sequencing of thisfragment on the reverse strand revealed a 13 bpinsertion at position 3520 in exon 16 in homo-zygous mutant mice. To confirm this finding, se-quencing with a new forward primer was per-formed, and yielded the same results (Fig. 2a). The π / hr rhY  mice bear this insertion in the hetero-zygous state (Fig. 2b). The revealed 13 bp insertionin exon 16 of   hr  gene in  hr rhY  / hr rhY  mice resultedin a frame shift and premature termination codonlocated in exon 17, 264 bp downstream from thesite of the insertion, and 139 bp upstream from theendogenous stop codon in exon 19. It is predictedthat no functional mRNA would be producedfrom this allele, due to degradation of mutanttranscripts bearing a premature termination codonby nonsense-mediated mRNA decay (NMRD)(26). 284 Figure 3 . Histological findings in 4.5-month-old rhino Yurlovo(A), hairless HRS/J (B), and rhino RHJ/LeJ (C) female mutantskin at the same magnification (hematoxylin & eosin). (A)Rhino Yurlovo skin is characterized by moderately enlargedutriculi (u), well-developed sebaceous glands (sg), and severalrows of large dermal cysts (dc). (B) Hairless skin contains utric-uli and sebaceous glands of similar size, but in contrast to Yur-lovo, only one row of dermal cysts is present. Note the well-developed adipose tissue (arrow) in hairless skin that is reducedin Yurlovo skin. (C) Rhino skin is characterized by prominentenlargement of utriculi, while dermal cysts and sebaceousglands are reduced in size. Scale bars Ω 100  m m.  Molecular basis for the rhino Yurlovo ( hr rhY   ) mutation in mice Figure 4 . Higher magnification of 4.5-month-old rhino Yurlovoskin (A, B) in comparison to the skin of an age-matched hetero-zygous animal (C) (hematoxylin & eosin). (A) A well-developedsebaceous gland is connected to the utricular cavity via the non-keratinized duct. The proximal pole of utricular epithelium isassociated with a cluster of ‘‘bulge-derived’’ cells (bg) (16, 28).(B) The dermal cyst in rhino Yurlovo skin. In contrast to hair-less mice, the sebocytes are numerous in the cystic epithelium,and are often assembled into gland-like clusters (arrows). (C)Normal telogen phase hair follicles in  π  /hr rhY  skin. Scale bars Ω 40  m m. Clinical and histological findings in hr rhY   /hr rhY  mice The heterozygous Yurlovo mutant mice ( π  /hr rhY  )have apparently normal fur cover that undergoesnormal cycles of regrowth (21). Histologicalstudies of 4.5-month-old homozygous ( hr rhY  / hr rhY  )Yurlovo mutant skin revealed obvious differencesto the skin of rhino mice. The characteristic histo-pathological feature of the rhino mutation is theexcessive dilatation of utriculi (Fig. 3) which is be-lieved to be the main pathomechanism of skinwrinkling and folding in rhino mice (27). The pro-cess of utricle dilatation in  hr rhJ   /hr rhJ  skin is associ-ated with a decrease in sebaceous gland and der-mal cyst size. At the age of 4.5 months, only a fewdermal cysts are present in  hr rhJ   /hr rhJ  skin, andonly occasional isolated sebocytes were observedat the base of the utricular epithelium (Fig. 3c) 285 (27). In contrast, in Yurlovo  hr rhY   /hr rhY  mutantmice, at the age of 4.5 months, the utriculi are notas large as in the rhino mutation. Instead, they aremore comparable with the size and structure of utriculi in hairless mice (Fig. 3). Furthermore, thesebaceous glands in 4.5-month-old  hr rhY  / hr rhY  skinare also comparable in size with the sebaceousglands of hairless mice of the same age, but arelarger as compared to rhino mice (Fig. 3a, b; Fig.4a). In the skin of Yurlovo mutant mice, epithelialcell clusters are visible just beneath the utricularproximal pole, which correspond to the putativebulge-derived cells (Fig. 4a). These cell structuresare characteristic of the mature skin of hairlessmutants (16, 28), but are absent in mature rhinomouse skin (Fig. 3c).In contrast to rhino, but quite similar to hairlessmutants, the skin of 4.5-month-old Yurlovo miceis characterized by the prominent enlargement of 
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks
SAVE OUR EARTH

We need your sign to support Project to invent "SMART AND CONTROLLABLE REFLECTIVE BALLOONS" to cover the Sun and Save Our Earth.

More details...

Sign Now!

We are very appreciated for your Prompt Action!

x