Investor Relations

A correlation of the endoscopic characteristics of colonic laterally spreading tumours with genetic alterations

Description
A correlation of the endoscopic characteristics of colonic laterally spreading tumours with genetic alterations
Published
of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  A correlation of the endoscopic characteristics of colonic laterally spreading tumours with genetic alterations Andrew J. Metz a , Michael J. Bourke a , Alan Moss a , Ashraf Dower b ,Peter Zarzour b , Nicholas J. Hawkins c , Robyn L. Ward b and Luke B. Hesson b Objectives  Laterally spreading tumours (LSTs) are aheterogeneous group of adenomas that are emerging asimportant precursors of colorectal cancer and in which therisk for cancer is related to their endoscopically definablemorphology. It is currently unclear whether differentmolecular alterations determine their morphologies.We aimed to assess this relationship in LSTs using strictmorphological classifications. Methods  We characterized 135 sessile adenomatouslesions (   20mm) according to histopathology and theParis classification. We investigated key molecular changescommonly found in colorectal neoplasms, namely mutationof  KRAS  ,  BRAF  ,  APC   and  CTNNB1  and microsatelliteinstability, and determined their relationship withmorphology. Results  The Paris classification revealed a heterogeneouscohort comprising Is/IIa+Is (41.5%), IIa/IIb (53.3%) andIIc/IIa+IIc (5.2%) lesions. Histopathological analysisshowed that 19 (14.1%) of these were sessile serratedadenomas. Here, we defined a group of 58 lesions thatshowed either Paris IIa or IIb morphology with no serratedhistopathology. These ‘classical LSTs’ showed thefollowing molecular characteristics: microsatelliteinstability 0/56 (0%),  APC   mutation 29/30 (96.7%), CTNNB1  mutation 2/55 (3.6%),  KRAS   mutation 24/55(43.6%) and  BRAF   mutation 2/55 (3.6%). Separationof lesions according to surface morphology showedthat  KRAS   mutations occurred much more frequentlyin granular (56.4%, 22/39) than in nongranular LSTs(12.5%, 1/16,  P  =0.004). Conclusion  The microsatellite instable pathway is notimportant in the development of LSTs, which areinstead likely to develop along a divergent chromosomalinstability pathway. We demonstrate the biologicalsignificance of endoscopic findings by showing that themorphological characteristics of LSTs are underpinnedby distinctive molecular profiles.  Eur J Gastroenterol Hepatol   25:319–326   c  2013 Wolters Kluwer Health |Lippincott Williams & Wilkins. European Journal of Gastroenterology & Hepatology  2013,  25: 319–326 Keywords: adenomas, colonoscopy, colorectal neoplasms,laterally spreading tumours a Department of Gastroenterology, Westmead Hospital,  b Adult Cancer Program,Lowy Cancer Research Centre and Prince of Wales Clinical School and  c Schoolof Medical Sciences, University of New South Wales, Sydney, New South Wales,AustraliaCorrespondence to Luke Benjamin Hesson, PhD, Adult Cancer Program,Lowy Cancer Research Centre and Prince of Wales Clinical School,University of New South Wales, Sydney, New South Wales 2052, AustraliaTel: +61 0 2 9385 1457; fax: +61 0 2 9385 1510;e-mail: l.hesson@unsw.edu.au Received  18 July 2012  Accepted  10 October 2012 Introduction Most colorectal cancers (CRCs) arise from adenomas,which can be divided into morphologically distinctsubtypes. Adenomas that protrude above the surroundingmucosa are termed polypoid adenomas (PAs), whereasthose that are only slightly elevated, completely flat orslightly depressed are termed nonpolypoid adenomas(NPAs) [1]. Until recently, the subtle morphologicalcharacteristics of NPAs made endoscopic detection of these lesions difficult. However, in the last few years,considerable improvements in endoscope technology such as high-definition imaging, magnification and chro-moendoscopy have enabled better characterization of these lesions. These have been categorized morphologi-cally using the Paris classification system [2], withpolypoid adenomas termed Ip if pedunculated or Is if sessile. In contrast, NPAs are termed IIa if slightly elevated (<2.5mm above the level of the surroundingmucosa), IIb if completely flat or IIc if depressed. Whenan otherwise nonpolypoid lesion develops a sessilepolypoid focus, it is referred to as a IIa+Is lesion.Laterally spreading tumours (LSTs) are a subtype of NPAs that show marked sideways growth within themucosa (by convention to >10mm in diameter). On thebasis of surface morphology on endoscopy, LSTs arefurther subclassified as granular lesions (G-LST), whichshow aggregates of nodules on their surface, or non-granular lesions (NG-LST), with a smooth surface. Although reported in the Japanese literature for almosttwo decades [3], only recently have LSTs become rou-tinely identified in Western countries, including USA,UK, Australia and Italy [4–7]. The progression of LSTs toCRC has been described in several studies, and when leftuntreated, progression can occur within a time framesimilar to that seen for polypoid lesions [1,8,9]. In onestudy, LSTs accounted for 5/21 (24%) of all lesions withearly invasive cancer [10]. Original article 319 0954-691X   c 2013 Wolters Kluwer Health | Lippincott Williams & Wilkins DOI: 10.1097/MEG.0b013e32835b57e7 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.  Previously, we and others have shown that the invasivepotential of lesions is closely related to the Paris classi-fication and surface morphology [11,12]. In lesionsstratified according to the Paris classification as eitherIIa, Is, IIa+Is or IIc/IIa+c, the risk for submucosalinvasive cancer (SMIC) was 3, 7, 13 and 46%, respec-tively. Furthermore, SMIC was observed in 15.3% of 98NG-LSTs but in only 3.2% of 311 G-LSTs ( P  <0.001)[11]. These studies show that NPAs (including LSTs)occur relatively frequently and that particular subtypes of LSTs, namely those with a Paris classification IIc/IIa+IIcor a nongranular surface morphology, show a higher risk for invasion. As such, LSTs are emerging as importantprecursors of CRC.It is now well accepted that colorectal neoplasia developsthrough distinctive molecular pathways, including thewell-characterized chromosomal instability (CIN) andmicrosatellite instability (MSI) pathways. Developmentalong the CIN pathway frequently involves inactivationof   APC   and activating mutations in  KRAS  , as well asfrequent changes in chromosomal copy number and struc-ture. Mutation or deletion of   APC  , which occurs in B 80%of CRCs, or mutation of the gene encoding the protein b -catenin ( CTNNB1 ) results in constitutive activation of the Wnt signalling pathway, and this is considered as a key initiating event in the development of polypoid adeno-mas, whereas mutation of the  KRAS   oncogene results inhyperactivation of mitogen-activated protein kinase(MAPK) signalling pathways.The MSI pathway is an alternate route for tumourigen-esis, characterized by defects in DNA mismatch repairenzymes. MSI is observed in  B 15% of sporadic CRCs,particularly those seen in older women, as a result of biallelic epigenetic inactivation of the  MLH1  gene.In CRC, MSI is frequently associated with  BRAF   mutation(an alternative route to MAPK pathway hyperactivation)and with a sessile morphology and serrated architecture inprecursor lesions [13–15]. It is also strongly associated withthe CpG island methylator phenotype [14,15]. Although the role of the CIN and MSI pathways in themolecular aetiology of polypoid adenomas is well esta-blished, the relative involvement of these pathways in thedevelopment of LSTs has not yet been directly tested.Previous studies, all in Japanese populations, have investi-gated a limited number of molecular features in LSTs buthave not as yet achieved consensus on their frequency.It is also not clear whether these lesions share acharacteristic molecular profile or whether particularmolecular alterations determine the different surfacemorphologies observed in LSTs. This lack of consensus inthe literature is understandable, given the inconsistentterminologies used to describe the lesions both clinically and pathologically [including variable reporting of sessileserrated adenomas (SSAs) as a form of LSTs] and thefrequent analysis of heterogeneous lesions within a givencohort. Consistent terminology for lesion descriptors isvery important as the frequencies of molecular changesmay be strongly influenced by the morphological subtypeof LST.In this report, we investigated a series of endoscopically resected LSTs from an Australian population. We focusedour investigation on Paris IIa or IIb lesions, which re-present a relatively homogeneous series of lesions with alaterally spreading pattern of growth, and included lesionswith both granular and nongranular surface morphologies. We investigated key molecular changes in these LSTs,including mutations in the Wnt pathway genes  APC   and CTNNB1  and the MAPK pathway genes  KRAS   and  BRAF  ,as well as the presence of MSI. In doing so, we sought todetermine the prevalence of these classical molecularfeatures of colorectal neoplasia in LSTs from a Westernpopulation in order to assess the relationship betweensurface morphology and molecular profile within thiscohort and better understand the molecular pathwaysinvolved in the development of LSTs. Methods Patients and tissue samples  All individuals in this study were referred to WestmeadHospital for the management of one or more large( Z 20mm in diameter) sessile adenomatous lesionsidentified during previous colonoscopy. Minimum lesionsize was prespecified at 20mm to ensure that only patients with typical expressions of LSTs were enrolled.Patients were enrolled in the Australian ColonicEndoscopic Mucosal Resection (ACE) study (ethicscommittee approval number 2008/9/6.1(2858), Sydney  West Area Health Service Human Research and EthicsCommittee), a multicentre prospective study conducted atseven Australian academic endoscopy units [11]. Samplesfrom all lesions were collected from a consecutive series of 125 individuals, including 63 (50.4%) men and 62 (49.6%)women, undergoing colonoscopy at Westmead Hospitalas part of the ACE study between July 2008 and April2009 (mean age 67.6±12.0 years). Procedures wereperformed by, or under the direct supervision of, twoexperienced interventional endoscopists. Lesions wereclassified according to established morphological criter-ia [2,16]. Lesions were assessed by white-light colonoscopy (Q180PCF/CF; Olympus, Tokyo, Japan) to determine lesionlocation, Paris classification [2] and surface morphology (granular, nongranular or indeterminate). A total of 135lesions were removed from these individuals by endoscopicmucosal resection as described by Moss  et al  . [11]. Tumourlocation within the large bowel was defined as eitherproximal or distal. Histopathology Tissue samples were fixed in a 10% buffered formaldehydesolution and embedded in paraffin for routine histopatho-logical assessment. The histological classification of all 320  European Journal of Gastroenterology & Hepatology  2013, Vol 25 No 3 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.  lesions was reviewed by two expert gastrointestinal patho-logists using standard diagnostic criteria. For adenomas,the degree of dysplasia was recorded as low grade, focalhigh grade or diffuse high grade. Mutation and microsatellite instability analysis DNA was extracted from formalin-fixed paraffin-em-bedded tissues using the QIAamp DNA Mini Kit 250(Qiagen, Hilden, Germany). The mutation status of the  APC   and  CTNNB1  genes was determined by PCR andDNA sequencing. The primer sequences used to amplify regions of the  APC   and  CTNNB1  genes are listed inTable 1. PCR products were sequenced using the BigDyeTerminator Cycle Sequencing kit (Life Technologies,Carlsbad, Cailfornia, USA) and analyzed using an ABI3730 Genetic Analyzer (Life Technologies). Mutationswere classified as any amino acid-altering sequencechange not described as a known single nucleotidepolymorphism within the UCSC genome browser (hg19,GRCh37, February 2009 assembly). Only sequencechanges confirmed on both forward and reverse DNA strands were recorded as mutations. Mutations of the KRAS   gene at codons 12 and 13 or of the  BRAF   gene atcodon 600 were assessed using pyrosequencing asdescribed previously [17]. MSI was assessed using themononucleotide markers Bat25, Bat26, Bat40 and Cat25as described previously [13]. Data analysis Differences in the clinicopathological and molecularcharacteristics between tumour subgroups were evalu-ated using  w 2 -tests for categorical variables and one-way analysis of variance for continuous variables. Statisticalsignificance was defined at a  P  -level of less than 0.05. Analyses were carried out using IBM SPSS software(version 19; SPSS Inc., Chicago, Illinois, USA). Results Tumour characteristics The full cohort of 135 lesions resected at endoscopy wasa heterogeneous group, which were classified according tothe Paris classification system as follows: 42 (31.1%) Is, 66(48.9%) IIa, six (4.4%) IIb, seven (5.2%) IIc or IIa+IIcand 14 (10.4%) IIa+Is. Details of the age and sex of affected individuals, along with the size, location, surfacemorphology and histopathological classification of thelesions are shown in Table 2, according to the endoscopicappearance of the lesion. Within this pathologically heterogeneous cohort, the molecular features of asses-sable lesions were as follows: MSI 0/133 (0%),  APC  mutation 57/58 (98.3%),  CTNNB1  mutation 4/128 (3.1%), KRAS   mutation 52/135 (38.5%) and  BRAF   mutation18/134 (13.4%). Given the heterogeneity of lesions, thecorrelation of molecular changes with macroscopicappearance was not assessed in this cohort. Frequency of key genetic alterations in classicallaterally spreading tumours and relationship with surface morphology To reduce the morphological complexity present withinthe initial cohort of lesions, we used specific endoscopicand histopathological characteristics to delineate a sub-group of lesions that best typified the biological entity of LST. Specifically, we included in this subgroup of ‘classical LSTs’ only those lesions that showed eitherParis IIa or IIb morphology, and we excluded all lesionsthat were diagnosed as SSAs by histopathological assess-ment. Examples of ‘classical LST’ lesions with granularand nongranular surface morphologies are shown in Fig. 1,whereas examples of morphologically diverse lesions thatwere excluded from further analysis in this study areshown in Fig. 2. The resultant 58 lesions (Table 3) in thisclassical LST group were resected from 54 individuals(32 men and 22 women; mean age 71.2±8.9 years, range53–90 years). The mean size of the lesions was30.5±11.2mm (range 20–75mm). Differentiation of lesions according to surface morphology (granular, non-granular or indeterminate) showed that G-LSTs weremore likely to arise in the proximal large bowel and weremore likely to have villous architectural elements whencompared with NG-LST ( w 2 -test,  P  >0.05). Within thiscohort of classical LSTs, mutations of   APC   were observedin 29 of the 30 (96.7%) assessable lesions, with two ormore mutations detected in 19 (63.3%) cases. Mutationsof   CTNNB1  were observed in two of 55 lesions (3.6%),one of which also had biallelic mutations of   APC  .Mutations of   KRAS   at codon 12 or 13 were observed in43.6% (24/55) of lesions, whereas V600E  BRAF   mutationswere found in only 3.6% (2/55) of lesions. The frequency of   BRAF   mutations in this classical LST group was muchlower than that in the entire cohort (18/134, 13.4%),and in this respect, it was noteworthy that 17/19 (79%)SSAs within the overall cohort contained a  BRAF  mutation.Differentiation of lesions according to surface morphology showed that  KRAS   mutations occurred much morefrequently in G-LST lesions (56.4%, 22/39) than inNG-LSTs (12.5%, 2/16,  w 2 -test,  P  =0.004; Table 4). All other comparisons of surface morphology withmolecular alterations were not statistically significant. Discussion LSTs are emerging as important precursors of CRC, inwhich the risk for cancer is related to their endoscopically classifiable morphology. It is currently unclear whetherdifferent molecular alterations cause these differences inmorphology. In this study, we determined the prevalenceof some of the common molecular features of CRC in awell-defined cohort of LSTs and have gained importantinsights into the molecular characteristics of differentsubtypes of LSTs defined by granular and nongranularsurface morphologies. Genetic analysis of homogeneous LSTs  Metz  et al  . 321 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.  Previous Japanese studies have yielded conflicting re-sults. This is because they have analyzed heterogeneouscohorts, not stratifying lesions according to the Parisclassification, histopathology or surface morphology. Thedefinitions of LSTs used in these studies included termssuch as ‘flat-type’ and often ignored the Paris classi-fication entirely [18–21]. These cohorts often containexamples of lesions that have developed a polypoidcomponent, a relatively common feature that tends tooccur in G-LSTs as they become more advanced. How-ever, the inclusion of such lesions potentially compro-mises attempts to identify the key molecular features of lesions showing a laterally spreading pattern of growth.The current study is based on a tightly defined group of lesions that are homogeneous in terms of both morphol-ogy and histopathology. We hypothesized that the dif-ferent morphological subtypes of LSTs may similarly reflect the involvement of different molecular pathways. We therefore focused our analyses on Paris IIa or IIblesions and excluded all sessile (Is and IIa+Is) or de-pressed (IIc/IIa+c) lesions as well as SSAs on the basisof the fact that they represent a fundamentally differenttype of lesions with a distinct histopathology and biology.The resulting group of classical LSTs included 55 IIalesions and three IIb lesions. This heavy skewing towardsthe IIa subgroup has the potential to mask any distinctivegenetic features of the IIb subgroup.Our initial molecular analysis of all 135 lesions in ourcohort (Table 2) showed that  BRAF   mutations weresignificantly more frequent in SSAs. This supports ourrationale for distinguishing SSAs from ‘classical LSTs’ by demonstrating that histologically distinctive lesions canshow different molecular profiles. This finding also reflectsthe heterogeneity within this nonclassical LST subgroup.The remaining subgroup of classical LSTs allowed us tobetter characterize the molecular features associated withgranular and nongranular surface morphologies.To date, there has been no investigation on theprevalence of microsatellite instability or  APC   mutationsspecifically in LSTs. Microsatellite testing showed thatall classical LSTs were microsatellite stable, as indeedwere all 135 lesions of the srcinal cohort. This is not Table 1  PCR primers used for mutation analysis of the  APC   and  CTNNB1  genes Gene Region analysed Forward primer (5 0 -3 0 ) Reverse primer (5 0 -3 0 ) APC   c.835–933;p.279–311CACTTCATTTGGAGTACCTTAACA CACCTGGCCAAGAATGTCc.2363–3013;p.788–1004AGCAGAGACACAAGCAAAGT CTAGGTCGGCTGGGTATTGAc.2849–3428;p.949–1142CTTATGCCAAATTAGAATAC TAATTGGTAGGCTTATCATCc.3336–4002;p.1112–1334AAATCGAGTGGGTTCTAATC GGATTTGGTTCTAGGGTGCTc.3882–4521;p.1294–1507GGAAGCAGATTCTGCTAATA ACTCAGGCTGGATGAACAAGc.4340–5173;p.1447–1724AAACCAAGCGAGAAGTACCT CAAGAATATCACCTTCCTCTG CTNNB1  c.64–174;p.29–58GAACCAGACAGAAAAGCGGCTG ACTCATACAGGACTTGGGAGG Table 2  Endoscopic appearances of all 135 lesions in the initial cohort Characteristics IIa or IIb ( n =72) IIc or IIa+c (depressed lesions;  n =7) Is or Is+IIa (sessile polyps;  n =56)Age (years; mean±SD) 70.1±9.2 73.0±5.2 62.2±16.2SexMale 36 4 23Female 31 3 28Size (mm; mean±SD) 30±11 34±13 36±13Site in large bowel [ n  (%)]Proximal 56 (78.9%) 3 (42.9%) 36 (64.3%)Distal 15 (21.1%) 4 (57.1%) 20 (35.7%)Morphology [ n  (%)]Granular 45 (63.4%) 4 (57.1%) 45 (80.4%)Nongranular 17 (23.9%) 3 (42.9%) 5 (8.9%)Mixed or indeterminate 9 (12.7%) 0 (0.0%) 6 (10.7%)Histopathological classification [ n  (%)]Tubular adenoma 29 (40.3%) 1 (14.3%) 17 (30.4%)Tubulovillous adenoma 27 (37.5%) 4 (57.1%) 26 (46.4%)Villous adenoma 0 (0.0%) 0 (0.0%) 3 (5.4%)Invasive cancer 2 (2.8%) 2 (28.6%) 5 (8.9%)Sessile serrated adenoma 14 (19.4%) 0 (0.0%) 5 (8.9%)Lesions showed significant differences in terms of size [analysis of variance (ANOVA),  P  =0.03], age (ANOVA,  P  =0.002), surface morphology ( w 2 -test,  P  <0.05) andhistopathology ( w 2 -test,  P  =0.02). Site and morphology were not specified for one lesion. 322  European Journal of Gastroenterology & Hepatology  2013, Vol 25 No 3 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.  surprising, as MSI tends to develop later during thecourse of neoplastic progression along this pathway and israrely seen in premalignant lesions [22]. However, thevery low rate of   BRAF   mutations in our classical LST cohort provided strong evidence that LSTs rarely, if ever,develop along the MSI pathway. In contrast, we were ableto show that somatic mutation of the  APC   gene occurredin almost all assessable LSTs, and in many cases, multiplemutations were identified suggestive of biallelic inactiva-tion. Although the complexity of analysis of the  APC   genemeant that almost half of the LSTs were noninformativefor the  APC   mutation, and hence were recorded asnonassessable, this noninformative group did not differfrom assessable lesions in terms of any clinicopathologicalcharacteristics. The difficulties in assessing  APC   muta-tions were related to the large size of the region analyzed(1799bp of coding DNA) and the possible occurrence of deletions within the  APC   gene. Mutation of the  CTNNB1 ( b -catenin) gene also occurred in a small proportion of cases. The involvement of the Wnt signalling pathway inLSTs has been described in previous studies on Japanesecohorts [18,23]. In a study by Sugimoto  et al  . [18],deletion of the  APC   gene locus occurred in 22% of 35G-LSTs and 47.4% of 19 NG-LSTs. Wang  et al  . [23]examined several downstream components of the Wntsignalling pathway using immunohistochemistry in aseries of 50 LSTs and 54 polypoid adenomas. Theexpression of   b -catenin, cyclin D1 and c-myc, as well asphosphorylation of GSK3 b , were all increased in LSTswhen compared with polypoid adenomas. However, todate, this is the first study to investigate the frequency of   APC   mutations in LSTs. Our data provide furtherevidence that hyperactivation of the Wnt pathway playsa major role in the molecular aetiology of LSTs. Changesin chromosome copy number and structure, as well as Wnt pathway hyperactivation, are a common feature of the CIN pathway. It is therefore noteworthy thatwidespread chromosomal loss and gain has been reported Fig. 1 Endoscopic appearance of ‘classical’ laterally spreading tumours. (a, b) IIa nongranular laterally spreading tumours. (c, d) IIa granular laterallyspreading tumours. Genetic analysis of homogeneous LSTs  Metz  et al  . 323 Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks