History

A Pilot Study on Brain-to-Plasma Partition of 10,11-Dyhydro-10-hydroxy-5H-dibenzo(b,f)azepine-5-carboxamide and MDR1 Brain Expression in Epilepsy Patients Not Responding to Oxcarbazepine

Description
We measured the brain-to-plasma partition of 10,11-dihydro-10-hydroxy-5H-dibenzo(b,f)azepine-5-carboxamide (10-OHCBZ) in epilepsy patients undergoing surgery to alleviate drug-resistant seizures and administered with different oral doses of
Categories
Published
of 8
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
   Epilepsia,  46 (10):1613–1620, 2005Blackwell Publishing, Inc. C   2005 International League Against Epilepsy A Pilot Study on Brain-to-Plasma Partition of 10,11-Dyhydro-10-hydroxy-5H-dibenzo(b,f)azepine-5-carboxamide and MDR1 BrainExpression in Epilepsy Patients Not Responding to Oxcarbazepine ∗ Nicola Marchi, ∗ Giovanna Guiso, ∗ Massimo Rizzi,  † Susanne Pirker,  ‡ Klaus Novak,  ‡ ThomasCzech,  † Christoph Baumgartner,  § Damir Janigro, ∗ Silvio Caccia, and ∗ Annamaria Vezzani ∗  Department of Neuroscience, Mario Negri Institute for Pharmacological Research, Milan, Italy; Departments of †Neurology and ‡Neurosurgery, University of Vienna, Vienna, Austria; and §Cerebrovascular Research Center, The Cleveland Clinic, Cleveland,Ohio, U.S.A. Summary:  Purpose:  We measured the brain-to-plasma par-tition of 10,11-dihydro-10-hydroxy-5H-dibenzo(b,f)azepine-5-carboxamide (10-OHCBZ) in epilepsy patients undergoingsurgerytoalleviatedrug-resistantseizuresandadministeredwithdifferent oral doses of oxcarbazepine (OXC). We addressed thepossiblecontributionofthemultidrugtransporterP-glycoprotein(P-gporMDR1)indetermining10-OHCBZbrainlevelsbymea-suring whether this active metabolite is a substrate of P-gp andthe relation between the level of expression of MDR1 and thedrug concentration in the same brain tissue specimens.  Methods:  Steady-state plasma and brain concentrations (C ss )of 10-OHCBZ were determined intraoperatively in 11 patientsby high-performance liquid chromatography (HPLC) with UVdetection. The level of expression of MDR1 mRNA was mea-sured in surgically resected brain tissue by reverse transcriptasepolymerase chain reaction (RT-PCR). The ability of 10-OHCBZto act as substate of P-gp was evaluated by measuring its uptakein cell lines expressing different levels of P-gp, in the presenceor absence of a selective P-gp inhibitor.  Results:  OXC was converted to 10-OHCBZ and to Di-OHCBZ, the two main metabolites measured in plasma. Thebrainconcentrationsoftheactivemetabolite10-OHCBZdidnotreflect plasma C ss . A significant inverse linear correlation wasfound between 10-OHCBZ brain-to-plasma concentration ratioand the level of brain expression of MDR1 mRNA. In vitro up-take studies demonstrated lower intracellular 10-OHCBZ levelsin cells with higher P-gp expression. Intracellular drug concen-tration was increased by XR9576, a specific P-gp blocker. Conclusions:  Pharmacologic failure of OXC in pharmacore-sistant epilepsy is unlikely to be due to alterations in drugmetabolism. 10-OHCBZ does not appear to cross the blood–brain barrier by simple diffusion, and it acts as a substrate of P-gp. The level of expression of MDR1 is inversely correlatedwith 10-OHCBZ concentration in the epileptic tissue. P-gp mayplayaroleinthepharmacoresistancetoOXCbydeterminingtheattainment of insufficient concentrations of its active metaboliteat neuronal targets.  Key Words:  Antiepileptic drugs—Blood–brain barrier—P-glycoprotein—Pharmacoresistance. Oxcarbazepine (OXC) has been used either inmonotherapy or in adjunctive therapy in patients withpartial-onset seizures with or without secondary gener-alization (1–4). OXC undergoes rapid 10-keto reductionto 10-hydroxy-10,11-dihydrocarbazepine (10-OHCBZ),which is the clinically relevant compound (3). Theantiepilepticactionof10-OHCBZappearstobeprimarilyduetoblockadeofthevoltage-dependentsodiumchannels(1).OXC has shown efficacy equivalent to that of otherantiepileptic drugs (AEDs) but significantly fewer side Accepted June 1, 2005.Address correspondence and reprint requests to Dr. A. Vezzani atLab Exp Neurol, Department of Neuroscience, Mario Negri Institute forPharmacologic Research, Via Eritrea 62, 20157 Milano, Italy. E-mail:vezzani@marionegri.it effects compared with carbamazepine (CBZ). However,OXC is ineffective in those clinical cases of epilepsy re-fractory to treatment with CBZ or to other first-line AEDs(1,4,5).The mechanisms underlying therapeutic failure of OXC, as well as of other AEDs, are largely unknown. Atleast two non–mutually exclusive hypotheses have beenproposed to explain pharmacoresistance (6–9): this phe-nomenonmayresultfromalteredAEDtargetsinepilepticbraintissueorfromtheattainmentofsubtherapeuticbrainconcentrationsofAEDsbecauseoftheirdiminishedbrainentry through the blood–brain barrier (BBB).A reduced brain uptake of AED may be mediated by afamilyofmultidrug-transportmembraneproteins(MTPs),which share the property of extruding from the cells,by an energy-dependent mechanism, a large variety of  1613  1614 N. MARCHI ET AL. structurally unrelated compounds (10). Several AEDs ap-pear to be substrates of MTPs, as shown by measuringAED transport in cell preparations overexpressing MTPs(11–13), or AED brain uptake in rodents lacking specificMTPgenes(14–17),orinnaiveratsadministeredtheAEDin the presence or in the absence of large-spectrum MTPblockers (18–20). MTPs, such as P-glycoprotein (gp) andspecificmembersofthefamilyofmultidrug-resistantpro-teins,areoverexpressedinendothelialcellsofbraincapil-laries, and in some instances also in astrocytes and in neu-rons,inpathologicbraintissueofdrug-refractoryepilepsypatients (11,13,21–26).Conclusive information about the possibility that AEDconcentrations below their therapeutic range are indeedreached in pharmacoresistant brain tissue is hamperedby the lack of appropriate control tissue from drug-responding patients. An additional obstacle for validatingthe MTP hypothesis is determined by the lack of specificinhibitors of MTP function, which impairs our ability todemonstrate unequivocally which AEDs are transportedby the various MTPs. However, potent and specific in-hibitors of P-gp became recently available, thus allowingus now to address this point (27,28).Inthispilotstudy,wemeasuredthesteady-stateconcen-trations (C ss ) of 10-OHCBZ in plasma and resected braintissue of pharmacoresistant patients treated with differ-ent oral dosages of OXC. We also assessed the relationbetween the brain-to-plasma concentration ratio of 10-OHCBZ and the level of expression of MDR1 mRNA,encoding P-gp, in the same brain tissue specimens. Fi-nally, we evaluated the ability of 10-OHCBZ to act as asubstrate of P-gp by using an in vitro model system andby blocking P-gp transport function by using the selectiveinhibitor XR9576 (27,28). MATERIALS AND METHODSHuman brain tissue specimens and plasma levels The investigations on human brain and plasma samplesconformed to the principles outlined in the Declarationof Helsinki. Patient consent was obtained as per Institu-tional Review Board instructions before collection of thespecimens.Alltheexperimentsinvolvedsmallportionsof human neocortical or hippocampal tissue, which were ex-cised for therapeutic reasons from 11 patients with phar-macoresistant epilepsy (Table 1). Brain specimens werechosenfromthemostepileptogenicareas(neocortexinpa-tients 2 and 3 and hippocampus in all other patients). Theresectionsweredonebasedonthepresurgicalevaluations,includingEEGs,byusingscalpandsphenoidalelectrodes,magneticresonanceimaging(MRI),functionalMRI,ictalsingle-photon emission computed tomography (SPECT),and neuropsychological tests including a Wada test. Insome patients, EEG recordings with subdural electrodesalso were performed.Braintissue( ∼ 200mg)wasrapidlyfrozenaftersurgicalremovalbyimmersioninliquidnitrogen.Approximately2mlofbloodwaswithdrawnbeforebraintissueresectioninheparinizedtesttubes;plasmawassubsequentlyseparatedby centrifugation and stored at –70 ◦ C until assay. All pa-tientshadtherapy-resistantseizuresaftertrialswithatleastthree antiepileptic drugs (AEDs). In some patients, treat-ment was reduced to OXC monotherapy before surgery(patients 5–11), whereas patients 1, 2, 3, 4, and 8 alsowere treated with clobazam, topiramate, lorazepam, lev-etiracetam, and clobazam + primidone, respectively. OXCloading was done orally in all patients 12 h before intuba-tionbyusingthesamedosepreviouslygiventothatpatientduring daily treatments (see Table 1). The time betweenintubationandtissueresectionrangedbetween2and4h. Total RNA extraction and reverse transcription Total RNA was isolated from brain samples accordingto the acid guanidium-phenol-chloroform method, as pre-viously described (17). After the extraction, 1 µ g of totalRNA from each sample was treated with 1 U of DNase(Invitrogen,S.GiulianoMilanese,Italy)andsubsequentlyused as a substrate for single-stranded cDNA synthesisby using murine leukemia virus reverse transcriptase (50U/  µ l; Perkin-Elmer, Emeryville, CA, U.S.A.), randomhexamers (2.5 µ  M  ), and deoxyNTP mix (1.25 m  M   each)in a final volume of 20 µ l. The mixture was incubated atroom temperature for 10 min, at 42 ◦ C for 15 min, at 99 ◦ Cfor 5 min, and at 5 ◦ C for 5 min. Real time-PCR analysis Reverse transcription was followed by real-time poly-merase chain reaction (PCR). Each unknown cDNA sam-ple was run in triplicate, together with a standard curvein the same plate. A standard curve was prepared as fol-lows:anidenticalvolumewaswithdrawnfromeachcDNAsample, corresponding to the srcinal brain tissue speci-mens (patients 1, 4, 5, and 7–11), and these aliquots werepooled together. The resulting aliquot, containing the av-erage amount of cDNA in the srcinal tissues, was used topreparethreedifferentserialconcentrations.TheunknowncDNA (MDR1 and the housekeeping gene β -actin) fromeach brain specimen was expressed as relative increaseinferred from linear regression analysis of the respectivestandardcurves.EachMDR1cDNAvaluewasnormalizedforthecorrespondingvalueofthehousekeepinggene.Thechoice of the  β -actin gene as an housekeeping gene wasbasedonourownpreviousevidenceshowingthatthelevelof this transcript does not significantly change in a largevariety of human epileptic tissues analyzed (see also ref.29).Realtime-PCRwasperformedbyGeneAmp5700SDS(Applied Biosystems, Monza, Italy) working at defaultoperating conditions as set by the manufacturer, by us-ing Sybr green as fluorescent dye. In brief, each cycleconsists of a 15-s denaturating step at 95 ◦ C followed by  Epilepsia, Vol. 46, No. 10, 2005  OXC AND P-GLYCOPROTEIN IN PHARMACORESISTANT EPILEPSY 1615 TABLE 1.  Clinical and experimental data of patients. Patient ID Frequency of Duration of OXC mg/ 10-OHCBZ 10-OHCBZ brain MDR1 mRNA brainAge, gender Pathology seizures (mo) epilepsy (yr) day plasma ( µ g/ml) ( µ g/g) relative increase140, maleTLE withouthippocampalsclerosis4–12 12 600 7.7 5.6 3.1238, femaleOligoastrocytomaWHO grade II,normalhippocampus2–4 4 1,200 12.1 5.6 n.d.339, maleTLE withhippocampalsclerosis, type 310 29 1,500 19.9 14.5 n.d.445, femaleTLE withouthippocampalsclerosis10 42 1,650 15.7 15.3 0.18565, maleTLE withouthippocampalsclerosis2–4 51 1,800 16.7 11.4 4.92635, maleTLE withhippocampalsclerosis, type 32 32 1,800 14.9 n.d. n.d.717, femaleTLE withhippocampalsclerosis, type 310 15 2,100 21.7 21.8 0.58838, femaleTLE withouthippocampalsclerosis8 34 2,100 16.3 16.8 2.02932, FemaleTLE withhippocampalsclerosis, type 37 23 2,400 24.3 0.6 5.241010, femaleTLE withhippocampalsclerosis, type 312 7 1,350 20.8 0.02 3.021110, femaleTLE withhippocampalsclerosis, type 36/yr 4 600 23.0 0.02 4.98This table shows the clinical and experimental data of the patients (nine adults and two children) whose plasma and brain specimens were used inthis study. All patients had focal complex seizures. The positive linear correlation assessed by regression analysis between the doses of OXC and theplasma levels of its main metabolites in the adult patients (1–9) is reported in Fig. 1. No correlation was found between the plasma and brain levelsof 10-OHCBZ, the active metabolite of OXC (y  =  15.37 – 0.35x; r 2 =  0.05; p  =  0.6). No correlation was found between the MDR1 level and thefrequency of seizures (r 2 = 0.49; p = 0.06) or the duration of epilepsy (r 2 = 0.11; p = 0.4). The negative linear correlation between the brain levels of 10-OHCBZ and the levels of expression of MDR1 mRNA in the same tissues is reported in Fig. 2A. n.d., Not determined. The degree of hippocampalpathology is determined according to ref. 42. In patient 2, mainly tumor material was used. a 60-s annealing-extension step at 60 ◦ C. The total num-ber of cycles was 40. Primers were designed according totheseoperativeconditionsbyusingthededicatedsoftwarePrimer Express (Applied Biosystems). Western blot P-gp levels were assessed in LoVo and LoVo/dx cells(see later). Cells ( ∼ 10 6 cells/dish) were harvested at 4 ◦ Candhomogenizedin20m  M  Tris-HClbuffer(pH,7.4)con-taining1%NP-40,1%Triton-X,1%Zwittergent,2 µ g/  µ laprotinin, 1 µ g/  µ l pepstatin, and 2  µ g/  µ l leupeptin. To-tal proteins were measured by using the Bio-Rad Protein Forward (5  →  3  ) Reverse (5  →  3  ) MDR1 CCTGCTGATCTATGCATCTTATGC CAAGGT GGTCCCATACCAGAAG β -Actin TGTCCACCTTCCAGCAGATGT CGGACT CGTCATACTCCTGCTT Assay (Bio-Rad Labs, Munich, Germany) and were sepa-ratedbyusingsodiumdodecylsulfatepolyacrylicgelelec-trophoresis(SDS-PAGE),10%acrylamide(100 µ g/lane).Proteins were transferred to Hybond nitrocellulose mem-branes by electroblotting.The immunologic determination of P-gp was obtainedby using the mouse monoclonal antibody C219 (VinciBiochem., Vinci, Italy; 1:500), and the immunoreactiv-ity was visualized with enhanced chemioluminescence(ECL; Amersham, UK), by using peroxidase-conjugatedgoat anti-mouse immunoglobulin (Ig)G (1:2,000; Sigma-Aldrich, St. Louis, MO, U.S.A.) as secondary antibody.Each sample was run in duplicate, and the corresponding  Epilepsia, Vol. 46, No. 10, 2005  1616 N. MARCHI ET AL. values were averaged to take into account variability dueto protein loading ( β -actin was used as reference pro-tein). Film exposures with maximal signals below thephotographic saturation point were used in the densito-metric analysis. Cellular uptake of 10-OHCBZ LoVo/dx cells are derived from human colon adeno-carcinoma cell lines (LoVo) and have been selected forresistance to doxorubicin (dx) because of a specific P-gpoverexpression (30,31). They express MDR1 mRNA lev-els  ∼ 30 times higher than their parent LoVo cell lines,which are doxorubicin sensitive.Cellular uptake of 10-OHCBZ was measured at 37 ◦ Cin 30-mm confluent Petri dish cultures  ∼ 10 6 cells/dish)in DMEM F12 medium (Gibco) containing 10% fetalbovine serum (FBS, Gibco) and 1% Vitamin Mix (SigmaAldrich). After washing with PBS at 37 ◦ C, 1.8 ml of T3cell buffer (Tris-HCl, 50 m  M  ; NaCl, 120 m  M  ; KCl, 50m  M  ; pH 7.4) was added in each dish. Cells were thenincubated in triplicate samples for 3 or 30 min with 50 µ g/ml 10-OHCBZ. Cellular uptake of 10-OHCBZ wasdetermined in LoVo/dx cells, in the presence or in the ab-sence of XR9576, a novel anthranilic acid derivative de-veloped as a potent and specific inhibitor of P-gp (27,28).LoVo/dx cells were preincubated for 2 h at 37 ◦ C with asolution with or without 1 or 20 µ  M   XR9576 in DMEMbefore exposure to 10-OHCBZ.The incubation was stopped by adding 1 ml of ice-coldT3; the cells were washed and then solubilized with 1 mlof 1% (wt/vol) Triton X-100 for 1 h at 37 ◦ C. The final so-lution obtained after solubilization, which contained theintracellular pool of 10-OHCBZ, was subsequently ana-lyzed by HPLC coupled with UV detection. Tissue drug extraction and measurement by HPLCwith UV detection OXC, 10-OHCBZ, and  trans -10,11-dyhydro-10,11-dihydroxy-5H-dibenzo(b,f)azepine-5-carboxamide (Di-OHCBZ) were extracted from plasma and brain ho-mogenates and measured with HPLC with UV detection(210nm)essentiallyaspreviouslydescribedforCBZ(17).Compounds were extracted from cells with 0.2 ml ace-tonitrile, and after centrifugation, the supernatant was an-alyzedwithHPLC-UV.SeparationwasdoneonaSpheri-5RP18Brownleecolumnwithamobilephaseconsistingof acetonitrile:methanol:n-butanol:0.01  M   phosphate buffer,pH 7.4 (14:14:0.5:71.5, vol/vol), delivered isocratically ataflowrateof1ml/min.Theretentiontimeswere17.1minforOXC,9.8minfor10-OHCBZ,7.7minforDiOHCBZ,and14.1minformephenytoin,theinternalstandard.Coef-ficients of variation for the precision and reproducibilityof the method ranged from 5 to 15%, regardless of thecompound and the tissue considered. Drugs OXC, 10-OHCBZ, and di-OHCBZ were kindly sup-plied by Novartis Pharma, Basel, Switzerland. XR9576was kindly provided by Dr. David Norris from XenovaLimited(Slough,Berkshire,U.K.).Allthechemicalsusedin this study were of the highest purity, and they werepurchased from Carlo Erba, Gibco, and Sigma Aldrich(Milan, Italy). Statistical analysis Data are expressed as mean  ±  SEM (n  =  number of individual samples). Least-square linear regression wasused to analyze the correlation between oral doses of OXC and the plasma concentrations of 10-OHCBZ andDi-OHCBZ (Fig. 1), and between the blood-to-brain ra-tio of 10-OHCBZ C ss  and the corrispondenting MDR1mRNA brain levels (Fig. 2A). One-way analysis of vari-ance followed by Tukey’s test was used to analyze thedifferences between 10-OHCBZ uptake ± P-gp inhibitorin cell lines (Fig. 2B). FIG. 1.  Relation between the oral dosages of oxcarbazepine(OXC;600to2,400mg/day)andtheplasmaconcentrationsof10-OHCBZ and DiOH-CBZ in pharmacoresistant epilepsy patients.In nine adult pharmacoresistant patients (1–9; mean age, 38.8 ±  6 years; see Table 1), OXC was metabolized in plasma to theactive metabolite 10-OHCBZ (solid squares) and to the inactivemetabolite DiOH-CBZ (open dots). Therapeutic plasma C ss  ( ∼ 15to 35  µ g/ml) were measured in eight of nine adult patients. Therelatively low blood concentration of the inactive metabolite Di-OHCBZ confirms that oxidation is a minor route of 10-OHCBZelimination. A positive linear correlation was found between thedoses of OXC and the plasma levels of its main metabolites (solidline; y  =  3,17  +  0.08x; r 2 =  0.741; p  <  0.01) and DiOH-CBZ(dotted line; y =  –0,766 + 0.018x; r 2 = 0.545; p < 0.05) by usingleast-squarelinearregressionanalysis.PlasmaC ss  of10-OHCBZwere associated with highly variable 10-OHCBZ brain concentra-tions, and no correlation was found between these parameters (y = 15.37 – 0.35x; r 2 = 0.05; p = 0.6; see Table 1). Data relative tothe two pediatric patients are reported in Table 1.  Epilepsia, Vol. 46, No. 10, 2005  OXC AND P-GLYCOPROTEIN IN PHARMACORESISTANT EPILEPSY 1617  FIG. 2. A:  The relation between the brain-to-plasma concentra-tion ratio of 10-OH-CBZ after different oral doses of OXC andthe relative MDR1 mRNA brain levels in eight pharmacoresistantepilepsy patients. All patients reported in Fig. 1 and Table 1 wereconsidered, except for patients 2, 3, and 6, because the brain lev-elsofMDR1mRNAwerenotavailable.Aninversecorrelation(y = 1.050–0.170x;r 2 = 0.553;p < 0.05)wasfoundbetweenthelevelof expression of MDR1 mRNA in resected epileptic hippocam-pal or cortical tissues and the corresponding brain-to-plasma 10-OHCBZ concentration ratio.  B:  Intracellular levels of 10-OHCBZin LoVo and LoVo/dx cells after 3-min drug incubation, and theeffect of 1  µ M   and 20  µ M   XR9576, a selective P-gp inhibitor,on the intracellular concentration of 10-OHCBZ in LoVo/dx cells.The intracellular levels of 10-OHCBZ were significantly lower inLoVo/dx than in LoVo cells; P-gp inhibition in LoVo/dx cells re-stored drug intracellular levels to those observed in LoVo cells.The inset depicts a representative Western blot of P-gp (170-kDaband) showing that LoVo/dx cells overexpress P-gp as comparedwith LoVo cells. Data represent mean ± SEM (n = 3), expressedasapercentageofthe10-OHCBZintracellularconcentrationmea-sured in LoVo cells.  ∗ p < 0.05 versus vehicle by one-way analysisof variance followed by Tukey’s test (statistical analysis was doneby using absolute values). RESULTSHuman specimens The results presented in this study were obtained from11 patients, nine adults and two children (seven femalesand four males); all these patients underwent surgery torelieve pharmacologically intractable seizures. The meanage of the adult patients was 38.8 ± 6 years, whereas thechildren were both 10 years old (see Table 1). In partic-ular, the nine adult patients (patients 1–9) were used forthebrain-to-plasmapartitionstudies,asdepictedinFig.1,whereas the data obtained in pediatric tissue (patients 10and 11) are reported in Table 1. Further analysis of datawasdoneonlyinthosepatients,sixadultpatients(patients1, 4, 5, and 7–9) and two children (patients 10 and 11),whereboth10-OHCBZbrain-to-plasmaconcentrationra-tio and MDR1 mRNA brain tissue levels were available(Fig. 2A). Plasma C ss  of oxcarbazepine and its main metabolites(10-OHCBZ and DiOH-CBZ) In all patients examined, the plasma C ss  values of OXCwerebelowthelimitofquantificationbyouranalyticpro-cedure. In the adult patients, the plasma C ss  of the activemetabolite 10-OHCBZ dose-dependently increased from7.7 µ g/mlat600mg/day(patient1)to24.3 µ g/mlat2,400mg/day (patient 9) (Table 1 and Fig. 1). Plasma C ss  of theinactive metabolite Di-OHCBZ ranged from 0.3 µ g/ml at600 mg/day to ∼ 3.1  µ g/ml at 2,400 mg/day, confirmingthat oxidation is a minor route of 10-OHCBZ elimination(Fig. 1). A positive linear correlation was found betweenoral doses of OXC (600 to 2,400 mg/day) and the plasmalevels of its two main metabolites 10-OHCBZ (Fig. 1,solid line; y = 3.17 + 0.08x; r 2 = 0.741; p  <  0.01) andDiOH-CBZ (Fig. 1, dotted line; y = –0,766 + 0.018x; r 2 = 0.545;p < 0.05).Moreover,the10-OHCBZplasmaC ss measuredineightofnineoftheseadultpharmacoresistantepilepsy patients (Table 1 and Fig. 1) and in the two chil-dren (patients 10 and 11; Table 1) were within the targetrange ( ∼ 15 to 35 µ g/ml) (2,3). Brain-to-plasma concentration ratio of 10-OH-CBZ Table 1 shows that plasma C ss  of 10-OHCBZ were as-sociated with highly variable 10-OHCBZ brain concen-trations. We examined the brain-to-plasma concentrationratioof10-OHCBZineightepilepsypatientsnotrespond-ing to oral OXC treatment (patients 1, 4, 5, and 7–11). Nocorrelation was found between brain and plasma levelsof 10-OHCBZ (y = 15.37 − 0.35x; r 2 = 0.05; p = 0.6).These findings suggest that 10-OHCBZ brain levels arenotmerelydependentonthepassiveinflux/outflowofthiscompound through the BBB.  Epilepsia, Vol. 46, No. 10, 2005
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks