Medicine, Science & Technology

A short-type peptidoglycan recognition protein from the silkworm: expression, characterization and involvement in the prophenoloxidase activation pathway

Description
Recognition of invading microbes as non-self is the first step of immune responses. In insects, peptidoglycan recognition proteins (PGRPs) detect peptidoglycans (PGs) of bacterial cell wall, leading to the activation of defense responses. Twelve
Published
of 10
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institutionand sharing with colleagues.Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third partywebsites are prohibited.In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further informationregarding Elsevier’s archiving and manuscript policies areencouraged to visit:http://www.elsevier.com/authorsrights  Author's personal copy A short-type peptidoglycan recognition protein from the silkworm:Expression, characterization and involvement in the prophenoloxidaseactivation pathway Kangkang Chen a , Chen Liu a , Yan He b , Haobo Jiang b , Zhiqiang Lu a,c, ⇑ a Department of Entomology, College of Plant Protection, Northwest A&F University, Yangling, Shaanxi 712100, China b Department of Entomology and Plant Pathology, Oklahoma State University, Stillwater, OK 74078, USA c Key Laboratory of Plant Protection Resources and Pest Management, Ministry of Education, Northwest A&F University, Yangling, Shaanxi 712100, China a r t i c l e i n f o  Article history: Received 20 November 2013Revised 18 January 2014Accepted 18 January 2014Available online 6 February 2014 Keywords: Pattern recognitionMelanizationInsect immunity Bombyx mori a b s t r a c t Recognitionofinvadingmicrobesasnon-selfisthefirststepofimmuneresponses.Ininsects,peptidogly-can recognition proteins (PGRPs) detect peptidoglycans (PGs) of bacterial cell wall, leading to the activa-tion of defense responses. Twelve PGRPs have been identified in the silkworm,  Bombyx mori , throughbioinformatics analysis. However, their biochemical functions are mostly uncharacterized. In this study,we found PGRP-S5 transcript levels were up-regulated in fat body and midgut after bacterial infection.Usingrecombinant proteinisolatedfrom Escherichia coli , weshowedthat PGRP-S5bindstoPGs fromcer-tain bacterial strains and induces bacteria agglutination. Enzyme activity assay confirmed PGRP-S5 is anamidase;wealsoshoweditisanantibacterial proteineffectiveagainstbothGram-positiveand-negativebacteria. Additionally, we demonstrated that specific recognition of PGs by PGRP-S5 is involved in theprophenoloxidase activation pathway. Together, these data suggest the silkworm PGRP-S5 functions asa pattern recognition receptor for the prophenoloxidase pathway initiation and as an effecter to inhibitbacterial growth as well. We finally discussed possible roles of PGRP-S5 as a receptor for antimicrobialpeptide gene induction and as an immune modulator in the midgut.   2014 Elsevier Ltd. All rights reserved. 1. Introduction Insects and other arthropods rely solely on innate immunity toprotect themselves against harmful microbes (Lavine and Strand,2002; Lemaitre and Hoffmann, 2007). Insect immune system con-sists of antimicrobial peptide production through IMD and Tollpathways (Hetru and Hoffmann, 2009), phenoloxidase (PO) cascade (Cerenius et al., 2008), and cellular responses such as phagocytosis (Strand, 2008). These pathways and responses are provokedbyrecognitionoftheintrudersasnon-selfthroughinter-action between host pattern recognition receptors (PRRs) andpathogen-associated molecular patterns (PAMPs) (Medzhitov and Janeway, 2002). PAMPs are conserved molecules on the microbialsurface, such as lipopolysaccharide (LPS) and peptidoglycans(PGs) in bacteria and  b -1,3-glucan in fungi. Peptidoglycans are  b -1,4-linked  N  -acetylglucosamine and  N  -acetylmuramic acid poly-mers crosslinked by short peptides. The crosslinking peptides varyinaminoacidresiduesandinthelinkageofstempeptidesindiffer-ent bacterial species. In Gram-negative bacteria and the Gram-po-sitivegenera Bacillus  and Clostridium , theglycanchainsaredirectlycrosslinked by  meso -diaminopimelic acid (DAP) containing pep-tides. In most Gram-positive bacteria, PGs have an interpeptidebridge and a lysine instead of DAP in the stem peptide (Kurataet al., 2006).Peptidoglycanrecognitionproteins(PGRPs)areafamilyofPRRsin innate immune system, which was first purified from the silk-worm  Bombyx mori  (Yoshida et al., 1996). The silkworm PGRP binds to Lys-type PG from  Micrococcus luteus  and is involved inprophenoloxidase (proPO) activation (Yoshida et al., 1996). Its mRNA is expressed in fat body, hemocytes and epidermal cellsand is up-regulated in fat body by injected bacteria (Ochiai and http://dx.doi.org/10.1016/j.dci.2014.01.0170145-305X/   2014 Elsevier Ltd. All rights reserved.  Abbreviations:  PG and PGRP, peptidoglycan and its recognition protein; LPS,lipopolysaccharide; DAP,  meso -diaminopimelic acid; SDS–PAGE, sodium dodecylsulfate–polyacrylamide gel electrophoresis; PO and proPO, phenoloxidase and itsprecursor; QRT-PCR, quantitative real-time PCR; PBS, phosphate buffered saline;BSA, bovine serum albumin. ⇑ Corresponding author at: Department of Entomology, College of Plant Protec-tion, Northwest A&FUniversity, Yangling, Shaanxi 712100, China. Tel.: +862987091997. E-mail address:  zhiqiang.lu@nwsuaf.edu.cn (Z. Lu).Developmental and Comparative Immunology 45 (2014) 1–9 Contents lists available at ScienceDirect Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci  Author's personal copy Ashida, 1999). Using ‘PGRP’ to search the NCBI Unigene database,we retrieved over a hundred entries, over half of which are frominsects. All PGRPs havea highlyconservedcarboxyl-terminal PGRPdomain (  160 amino acid residues in length) homologous to bac-teriophage T7 lysozyme (Ochiai and Ashida, 1999; Kang et al.,1998), while the amino-terminal region is unique for a given PGRPwith no or low similarity to other PGPR members.  Drosophila  gen-ome contains thirteen PGRP genes encoding nineteen proteinsthrough alternative splicing (Werner et al., 2000). A recent review summarized the structures and functions of these PGRPs in Drosophila  immune system (Kurata, 2014).  Drosophila  PGRP-SAand -SD circulate in hemolymph, detect Lys-type PGs of mostGram-positive bacteria, and activate a serine protease cascade toinduce antimicrobial peptide gene transcription through the Tollpathway (Michel et al., 2001; Bischoff et al., 2004; Charrouxet al., 2009). PGRP-LC and -LE are receptors in the IMD signalingpathway (Choe et al., 2002; Gottar et al., 2002; Ramet et al.,2002; Takehana et al., 2002, 2004). Membrane-bound PGRP-LCxplaysakeyroleinsensingDAP-typePGsofGram-negativebacteriaand Gram-positive  Bacilli , while PGRP-LCa/x heterodimers recog-nize tracheal cytotoxin (TCT) of Gram-negative bacteria (Neyenetal.,2012).CytosolicPGRP-LEdetectsTCTandformshomodimersto trigger the IMD pathway (Lim et al., 2006). In an intracellularbacteria  Listeria monocytogenes – Drosophila  infection model,PGPR-LE plays a crucial role as the receptor for autophagy and isresponsible for induced synthesis of an antibacterial peptide liste-ricin (Yano and Kurata, 2008; Goto et al., 2010). PGRP-LC and -LEcooperatively contribute to gut immune response, with a masterrole of PGRP-LE that induces limited responses to pathogenic bac-teria and tolerance to microbiota in the intestine (Neyen et al.,2012; Bosco-Drayon et al., 2012). PGRP-LC and PGRP-SC1 are in-volved in phagocytosis as well, though the mechanisms are stillunknown(Rametetal., 2002;Garveretal., 2006). Besidestheroles as a receptor to detect PG from bacteria, PGRPs also function asregulators to modulate immune responses. PGRP-LA is primarilyexpressed in barrier epithelia and positively regulates the IMDpathway (Gendrin et al., 2013). PGRP-LF acts as a specific negative regulator of IMD pathway, probably through competition withPGRP-LCa for the binding to PGRP-LCx (Maillet et al., 2008;Basbous et al., 2011). Owing to the  N  -acetylmuramoyl- L -alanineamidaseactivitythathydrolyzestheamidebondbetweenMurNAcand  L -alanine in PG, PGRP-SC1/2 and -LB may functionas scaveng-ers to break down PGs and thus down-regulate inflammatory re-sponses via IMD pathway (Mellroth et al., 2003; Bischoff et al.,2006; Zaidman-Rémy et al., 2006). PGRP-SB1 shows bactericidaleffect stemmedfromits amidase activity, while its role in immunesystemneeds further study (Mellroth and Steiner, 2006; Zaidman- Rémy et al., 2011).There are twelve PGRP genes in the  B. mori  genome (Tanakaet al., 2008). PGRP-S1, the first PGRP discovered by Yoshida et al.(1996), is functionally characterized. In this study, we producedtherecombinantPGRP-S5andinvestigatedits PG-bindingspecific-ity,amidaseactivity,antibacterialactivity,andfunctioninimmuneresponse. Our results provided evidence that PGRP-S5 plays dualrolesinthesilkworm,servingasareceptorfortheproPOactivationpathway and as an antibacterial protein. 2. Materials and methods  2.1. Insect rearing, bacterial challenge, and tissue collection Silkworm ( Nistari ) eggs were kindly provided by Dr. Erjun Lingin Shanghai Life Science Institute. Newly hatched larvae werereared to 5th instar on fresh mulberry leaves at 27±1  C,photoperiod 14L:10D, and 65±10% relative humidity. Theindigenousbacteriawereeliminatedby5 l l(10 l g/ l l)tetracyclineindietblock(4mm  4mm  2mm)foreach5thinstarlarva(day3) before oral infection. The bacteria  Pseudomonas aeruginosa  and Staphylococcus aureus  were cultured overnight in Luria–Bertani(LB) medium with constant shaking at 37  C and then harvestedby centrifugation at 8000  g   for 10min. Infection was conductedby feeding each silkworm on artificial diet containing sterilized0.85% NaCl (negative control), 2  10 9 P. aeruginosa  or 1.4  10 8 of   S. aureus  in the sterilized saline. Each treatment group included15 larvae. At 8 and 24h after the larvae consumed the diet blocks,alltreatedinsectsfromeachgroupweredissectedwithmidguttis-sue collected and stored in Trizol reagent (Invitrogen) at   80  C.For collecting fat body and hemocytes from challenged larvae,1  10 7 cellsof bacteriain50 l l sterilizedsalinewereinjectedintohemocoel of eachlarva. Thecontrolswereinjectedwith50 l l ster-ilizedsaline. At differenttimepointsafterinjection, 15larvaefromeach group were dissected to collect hemolymph and fat body.Cell-free hemolymph was removed after centrifugation at 500  g  for10minat4  C.Thehemocytepelletsandfatbodysamplesweretreated with Trizol reagent and stored at  80  C.  2.2. RNA isolation and cDNA preparation Themidgut,fatbodyandhemocytesampleswerehomogenizedby a pellet pestle (Kontes) and total RNA of each tissue was ex-tracted using Trizol reagent according to the protocol. The totalRNA was purified by RNeasy MinElute Cleanup Kit (Qiagen) withgenomic DNA removed by DNase treatment (Promega). First-strand cDNA was synthesized from purified RNA (1 l g) usingSuperScript™ III reverse transcriptase (Invitrogen) following themanufacturer’s instructions. A 260  and A 280  of each sample weredetermined on a Biophotometer (Eppendorf) to calculate concen-trations and A 260 /A 280  values. The cDNA samples were diluted to50ng/ l lwithdeionizedwaterandemployedastemplatesinquan-titative real-time (QRT)-PCR analysis.  2.3. QRT-PCR analysis Two BmPGRP-S5 gene-specific primers 5 0 -TGACTTCTGCCGACCTGACAC-3 0 and 5 0 -TTTCCATCCATTGCCACACACC-3 0 were used toamplifyaproductof172bp.A192bpcDNAfragmentofthehouse-keeping gene, IF4A (DQ443290.1), was amplified as an internalcontrol to normalize the transcript level of PGRP-S5 using 5 0 -TCTGGCATCATACCTTCTACAA-3 0 and 5 0 -TCTGTGTCATCTTTTCCCTGTT-3 0 (Wu et al., 2010). QRT-PCR was performed in a total volume of 20 l l containing 10 l l of 2  FastStart Essential DNA Green Master(Roche),1 l lofcDNA,1 l lofeachprimer(10 l M)and7 l lofdoubledistilledwater.QRT-PCRwasconductedunderthefollowingcondi-tions:initialdenaturationat95  Cfor10min,followedby40cyclesof denaturation at 95  C for 15s, annealing at 60  C for 20s, andextension at 72  C for 30s. Melt curve (55–95  C) was determinedto confirm the amplification of specific PCR product (Bio-Rad IQ5).Standardcurvesofthetwogenes(BmPGRP-S5andIF4A)weremea-suredtofindouttheamplificationefficiencyand r  2 value.Therela-tive quantitative method (2  DD Ct ) was used to determine theexpression level changes (Schmittgen and Livak, 2008). The data wereplottedusingPrism5.0(GraphPadSoftware,Inc)andanalyzedbyStudent’s t  -test.  2.4. Cloning, expression and purification of BmPGRP-S5 The entire PGRP-S5 coding region was amplified by PCR underthe same conditions (Section 2.3) using the following primers(forward: 5 0 -GCATATGCATCCTCGGCTTATCGAAAA-3 0 with  Nde Isite; reverse: 5 0 -GCTCGAGTGTCTGTTTATTTAGTTCTC with  Xho Isite). The PCR product was isolated from gel and purified by Gel 2  K. Chen et al./Developmental and Comparative Immunology 45 (2014) 1–9  Author's personal copy Extraction (Omega A). The fragment was inserted into pMD19-Tvector (TaKaRa) and then transformed into  Escherichia coli  JM109.TheplasmidwasextractedbyPlasmidMiniKit(OmegaA)andcon-firmed by sequencing (Shanghai Sunny Biotechnology Co).AmodifiedpET28bwasusedtoexpress,purify,anddetectPGRP-S5,whichencodesasmallubiquitin-likemodifier(SUMO)ledbyanamino-terminalhexahistidineaffinitytag.The106-residuepeptidedomain, encoded by an  Nco I– Nde I fragment, was employed to in-crease solubility of recombinant protein and can be removed by aproteasethatspecificallyrecognizesthetertiarystructureofSUMO.Two oligonucleotides (5 0 -TAT C GATTACAAGGATGACGACGATAAG CATATG-3 0 and 3 0 -A G  CTAATGCTTCTACTGCTGCTATTCGTATACCTAG-5 0 , encoding the FLAG tag DYKDDDDK) were phosphorylated,annealed, and inserted between the  Nde I and  Bam HI sites. Thesrcinal  Nde I site was eliminated by the mutation (CATAT C)  and anew  Nde I site was added in front of the  Bam HI site. Similarly, ac-Myc tag was introduced between  Hin dIII and  Xho I sites of thevector using 5 0 -AGCTTCTCGAGCAGAAGCTCATCTCTGAAGAGGATCTGTAG  T- 3 0 and 3 0 -AGAGCTCGTCTTCGAGTAGAGACTTCTCCTAGACATC  A AGCT-5 0 (encoding EQKLISEEDL  ⁄ ). The srcinal  Xho I site waseliminatedbythemutation(  T  TCGAG )  andanew  Xho I siteis addednexttothe Hin dIIIsite.In-framecloningofthecodingsequenceintothe  Nde I and  Xho I sites of pSFM (standing for SUMO, FLAG, c-Myc)would render recombinant fusion proteins detected by commer-cially available monoclonal antibodies against either tag. Aftersequencing verification, pSFM was double digested with  Nde I and  Xho I, ligated with the PGRP-S5 cDNA insert retrieved frompMD19-T, and then transformed into  E. coli  BL21.The  E. coli  BL21 cells were inoculated into LB medium contain-ingkanamycin(50 l g/ml), growntothelogarithmicphaseat 37  Cwith shaking at 240rpm, and then induced by IPTG at a final con-centrationof0.5mMfor10hat25  Cwithshakingat150rpm.Thebacteria were harvested by centrifugation at 8000  g   for 10min at4  C, suspended in phosphate buffered saline (PBS, pH 7.4) at5ml per gram of wet bacteria, incubated with lysozyme at a finalconcentration of 0.1 l g/ml for30minat roomtemperature, andfi-nally lysed by ultrasonication (130Watt, 20kHz, 10  10s). TheBmPGRP-S5 was first purified by affinity chromatography on aNi 2+ –NTA agarose column (Qiagen). The purified protein was di-gested by SUMO protease (GeneCopoeia) at 4  C overnight andpurified on the Ni 2+ –NTA column again to remove cleaved SUMOand uncleaved fusion protein. To detect induced expression of PGRP-S5 and monitor its purification, proteins were separated by12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis(SDS–PAGE), followed by staining with Coomassie Brilliant BlueR250 and immunoblot analysis using anti-c-Myc (1:20,000 dilu-tion, Cwbio) as primary antibody and goat-anti-rabbit IgG(1:20,000 dilution, Santa Cruze) as secondary antibody, and thenmass spectrometry was used to verify the purified recombinantPGRP-S5.  2.5. Binding of BmPGRP-S5 to PGs Insoluble PGs from  M. luteus ,  S. aureus ,  Bacillus megaterium , and Bacillus subtilis  were prepared as described previously (Sumathi-pala and Jiang, 2010).  E. coli  PG was purchased from InvivoGen.PGs (10 l l, 10 l g/ l l) or 10 l l PBS was incubated with the purifiedPGRP-S5 (20 l l, 0.2 l g/ l l) at room temperature for 2h. The mix-ture was centrifuged at 4  C, 10,000  g   for 15min. The supernatantwas saved as unbound sample; PBS mixed with PGRP-S5 wasregarded as control of total proteins. Then the pellet was spundownafterbeingwashedwith30 l l of 50mMNaCl, 150mMNaCl,and 500mM NaCl in PBS sequentially, and the 150mM NaClsupernatant was taken as the wash sample. Finally, the pelletwas suspendedwith30 l l PBSas the boundsample. The four sam-ples were treated with 10 l l 4  SDS sample buffer at 95  C for5min. After centrifugation at 13,000  g   for 5min, the samples(10 l l) were separatedby 12%SDS–PAGEfollowedby immunoblotanalysis using anti-c-Myc and goat-anti-rabbit IgG as described inSection 2.4.  2.6. Bacterial agglutination assayM. luteus ,  P. aeruginosa ,  S. aureus, E. coli  and  Serratia marcescens were used to test possible role of PGRP-S5 in bacterial agglutina-tion.Thebacteriainmid-logarithmicphasewereharvestedanddi-luted with PBS to 2  10 8 cells/ml ( M. luteus ,  E. coli ,  P. aeruginosa )and 1  10 7 cells/ml ( S. aureus ,  S. marcescens ). The diluted bacteriasuspensions (10 l l) were separately mixed with 10 l l PGRP-S5(200 l g/ml) or BSA (200 l g/ml), incubated in a 96-well plate atroomtemperaturefor 2h, andobservedunder aninvertedfluores-cence microscope (AMG, EVOS FL).  2.7. Amidase activity determination Insoluble PGs from  E. coli ,  M. luteus ,  B. subtilis ,  S. aureus  and  B.megaterium  were suspended in PBS and briefly sonicated. EachPG sample (10 l l, 1mg/ml) was incubated with 50 l l PGRP-S5(40 l g/ml) or 50 l l lysozyme (40 l g/ml) in PBS at room tempera-ture on a Tube Tumbler (Select Bioproducts). The decay of lightscatteringat405nmwasmeasuredafter0,1,2,4,and8honaBio-photometer (Eppendorf).  2.8. Antibacterial activity assayM. luteus , S. aureus, S. marcescens and E. coli culturesweregrowntoOD 600  0.6inLBmediumat37  Cwithshaking.Bacteriain200 l lcultures were harvested by centrifugation at 8000  g   for 10min at4  C and resuspended in 200 l l of PBS. After 1:100 dilution, thebacterial suspensions (10 l l) were mixed with 25 l l, 40 l M ZnCl 2 in PBS or 200 l g/ml PGRP-S5 in the same buffer in 1.5ml tubes.After shaking on a Tube Tumbler for 5h at room temperature,the mixtures were individually mixed with 1ml LB and culturedat 37  C overnight prior to absorbance measurement at 600nm.  2.9. Prophenoloxidase activation Day1,5thinstarlarvaewereplacedontheiceandsurfacedisin-fected with 70% ethyl alcohol and hemolymph was collected fromcut caudal horn, and the hemolymph was centrifuged at 16,000  g  for 30s to remove hemocytes. Four reactions were prepared: (1)15 l lPBSand5 l lplasma;(2)2 l lPGRP-S5(200 l g/ml),5 l lplasmaand 13 l l PBS; (3) 5 l l plasma and 13 l l PBS; (4) 2 l l PGRP-S5(200 l g/ ml), 5 l l plasmaand11 l l PBS. After incubationoniceforfive min, the reaction mixtures (3) and (4) were reacted with 2 l lPG (1mg/ml). After incubation on ice for two more minutes, thereactionmixtureswerecentrifugedat1000  g  for1min.Thesuperna-tants (5 l l) were individually transferred to microplate wells andmixedwith100 l lof2mMdopaminein50mMsodiumphosphate,pH 6.5 for PO activity determination at 490nm on a plate reader( Jiangetal.,2003). 3. Results  3.1. PGRP-S5 sequence analysis, expression profiling upon bacterialinfection, and recombinant protein production From the silkworm cDNA database (http://sgp.dna.affrc.go.jp/FLcDNA), we identified a cDNA sequence (accession number:NM_001043393) for PGRP-S5 (Tanaka et al., 2008; Suetsugu K. Chen et al./Developmental and Comparative Immunology 45 (2014) 1–9  3  Author's personal copy et al., 2013). The first part of the cDNA (nucleotides 1–102)represent exon 1 including a 5 0 UTR and MFLSFCIFIVFCAYTSSHPRL IEKcoding region. The underlinedsequence represents a predicted17-residue signal peptide. The remaining cDNA sequence (nucleo-tides103–673)correspondstoexons2–4codingforDHLSVDFPVCSRDCWGA . . .  GALLEEVSTWDNYHPGHVNFRELNKQTKF ⁄ , where theomitted part is a 191-residue PGRP domain. The open readingframe is directly followed by a poly(A) tail since there is a polyad-enylation signal AATAAA encoding NK near the carboxyl terminus.In the structure of   Drosophila  PGRP-LB (an active amidase), His42,Tyr78, His152 and Cys160 interact with zinc and Thr158 is a sur-face residue at the active site for PG binding (Kim et al., 2003). In Drosophila  PGRP-SA (non-catalytic), the replacement of His152and Cys160 (PGRP-LB numbering) by Gly150 and Ser158 result inthe loss of zinc binding activity (Reiser et al., 2004). Sequencealignment shows that the five conserved residues critical for zincbinding and PG interaction in  Drosophila  PGRP-LB are present insilkworm PGRP-S5 (Fig. 1A). Phylogenetic analysis revealed thatsilkworm PGRP-S5 was grouped with  Drosophila  PGRP-LB and Manduca sexta  PGRP-2 with the T7 lysozyme as the root (Fig. 1B)suggesting  B. mori  PGRP-S5 may have amidase activity.To investigate the role of BmPGRP-S5 in silkworm immunity,we first examined the change of its mRNA level by quantitativereal-time PCR after injection of live bacteria into hemocoel orthroughnaturaloralinfection.Infatbody,injectionof  P. aeruginosa caused BmPGRP-S5 transcription level increased significantly until48hpi; S. aureus injectioncausedtheincreaseuntil24hpi(Fig.2A).Inhemocytes, injectionof  P. aeruginosa  ledtoanincreasefrom4to24hpi, whereas S. aureus  injectioninducedBmPGRP-S5expressionfrom 4 to 8hpi (Fig. 2B). After we challenged silkworm larvaethrough oral route, the PGRP-S5 transcript level in midgut in-creased remarkably in response to  S. aureus  from 8 to 16hpi;  P.aeruginosa  ingestion did not induced a significant change in thePGRP-S5 mRNA levels on the contrary (Fig. 2C).To produce sufficient protein for functional study, we clonedthe entire open reading frame, expressed the mature PGRP-S5(HPR  . . . NKQT) in  E. coli , and purified the recombinant protein.The cDNA was inserted into the pSFM expression vector, whichhas a 6  His tag followed by a SUMO cleavable tag at the ami-no-terminus and FLAG and c-Myc tags flanking the  Nde I and  Xho Isites. The soluble fusion protein was produced at a high level in E. coli . AfterweisolatedthefusionproteinusingNi 2+ –NTAcolumn, Fig. 1.  Multiple PGRP sequence alignment using ClustalW (A) and construction of phylogenetic tree (B). Identical and similar amino acid residues are shaded in black andgray,respectively.Theresiduesresponsibleforzincbindingandamidaseareindicatedwitharrows.Thescalebaronthebottomofthetreeindicatesthedistance.Numbersonthebranchesrepresentthedistances.Bm, B. mori  (PGRP-S5:NP_001036858.1;PGRP:BAA77209);Ha, Helicoverpa armigera  (PGRP-B:AFP23116;PGRP-CAFP23117);Sr, SamiaCynthia ricini  (PGRP-A: BAF03522; PGRP-B: BAF03520); Ms,  M. sexta  (PGRP-1: AF413068; PGRP-2:ACX49764); Dm,  D. melanogaster   (PGRP-LA: CG32042; PGRP-LB:CG14704;PGRP-LC:CG4432;PGRP-LE:CG8995;PGRP-LF:CG4437;PGRP-SA:CG11709;PGRP-SB1:CG9681;PGRP-SB2:CG9697;PGRP-SC1a:CG14746;PGRP-SC2:CG14745;PGRP-SD:CG7496); Gm,  Glossina morsitans  (PGRP-LB: ABC25064); Ag,  Anopheles gambiae  (PGRP-LB: XP_003435776); Tc,  Tribolium castaneum  (PGRP-SA: XP_969883).4  K. Chen et al./Developmental and Comparative Immunology 45 (2014) 1–9
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks