Presentations & Public Speaking

A small deletion in the olive fly acetylcholinesterase gene associated with high levels of organophosphate resistance

Description
A small deletion in the olive fly acetylcholinesterase gene associated with high levels of organophosphate resistance
Published
of 7
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  A small deletion in the olive fly acetylcholinesterase gene associated withhigh levels of organophosphate resistance E.G. Kakani a , I.M. Ioannides b , J.T. Margaritopoulos c , N.A. Seraphides b , P.J. Skouras c , J.A. Tsitsipis c , K.D. Mathiopoulos a,  a Department of Biochemistry and Biotechnology, University of Thessaly, Ploutonos 26, Larissa 41221, Greece b  Agricultural Research Institute, Nicosia 1516, Cyprus c Laboratory of Entomology and Agricultural Zoology, Department of Agriculture, Crop Production and Rural Environment, University of Thessaly, Nea Ionia 38446, Greece a r t i c l e i n f o  Article history: Received 7 October 2007Received in revised form22 April 2008Accepted 12 May 2008 Keywords:Bactrocera oleae Olive flyAcetylcholinesteraseInsecticide resistanceDimethoate a b s t r a c t Organophosphate resistance in the olive fly was previously shown to associate with two pointmutations in the  ace  gene. The frequency of these mutations was monitored in  Bactrocera oleae individuals of increasing resistance. In spite of the difference in resistance among the individuals, therewas no correlation between mutation frequencies and resistance level, indicating that other factors maycontribute to this variation. The search for additional mutations in the  ace  gene of highly resistantinsects revealed a small deletion at the carboxyl terminal of the protein (termed  D 3Q). Significantcorrelation was shown between the mutation frequency and resistance level in natural populations. Inaddition, remaining activity of acetylcholinesterase enzyme (AChE) after dimethoate inhibition washigher in genotypes carrying the mutation. These results strongly suggest a role of   D 3Q in high levels of organophosphate (OP) resistance. Interestingly, the carboxyl terminal of AChE is normally cleaved andsubstituted by a glycosylphosphatidylinositol (GPI) anchor. We hypothesize that  D 3Q may improve GPIanchoring, thus increasing the amount of AChE that reaches the synaptic cleft. In this way, despite thepresence of insecticide, enough enzyme would remain in the cleft for its normal role of acetylcholinehydrolysis, allowing the insect to survive. This provides a previously un-described mechanism of resistance. &  2008 Elsevier Ltd. All rights reserved. 1. Introduction There is a growing concern about the recent increase of pesticide use, which has led to the development of resistance.More so, considering that a growing number of field populationsof insects develop multiple resistance to more than oneinsecticides. Modification of the acetylcholinesterase enzyme(AChE) has been implicated in several cases of resistance againstorganophosphate (OP) and carbamate (CB) insecticides (O’Brien,1976; Matsumura, 1985). Normally, acetylcholinesterase hydro- lyzes the acetylcholine (Rosenberry, 1975) at the neural synapsesand terminates the nerve pulse. OPs and CBs enter the active sitegorge of the enzyme and phosporylate or carbamoylate, respec-tively, the active site serine of AChE. However, the reaction rate of dephosphorylation or carbamoylation of the insecticides is veryslow and, consequently, fewer molecules of the enzyme areavailable for the hydrolysis of acetylcholine. The acetylcholine isaccumulated in the neural synapse, the acetylcholine receptorremains permanently opened, thus causing the death of the insect(Aldridge, 1950).In contrast, a modified AChE that confers resistance displaysdecreased affinity to OPs and CBs than that of the susceptibleenzyme. Several mutations have been identified in the gene forAChE (termed  ace ) of different insects. In almost all cases, thesemutations affect amino acid residues that are predicted to belocated in the active site gorge of the enzyme (Mutero et al.,1994).They all point to a mechanism that involves a steric alteration of the active site residues in such a way that affect the entrance andthe binding of the OP insecticide into the active site (Harel et al.,2000) and the efficiency of AChE phosphorylation.Such mutations have been described in  Drosophila melanoga-ster   (Fournier et al., 1992b; Mutero et al., 1994), in mosquito species (Nabeshima et al., 2004; Weill et al., 2004), in  Muscadomestica  (Williamson et al.,1992; Feyereisen,1995; Kozaki et al., 2001; Walsh et al., 2001),  Bactrocera dorsalis  (Hsu et al., 2006),  Aphis gossypii  (Andrews et al., 2004; Toda et al., 2004), as well as in other hemipteran species ( Javed et al., 2003). The onlydocumented report of a resistance-associated mutation outside ARTICLE IN PRESS Contents lists available at ScienceDirectjournal homepage: www.elsevier.com/locate/ibmb Insect Biochemistry and Molecular Biology 0965-1748/$-see front matter  &  2008 Elsevier Ltd. All rights reserved.doi:10.1016/j.ibmb.2008.05.004  Corresponding author. Tel.: +302410565284; fax: +302410565290. E-mail address:  kmathiop@bio.uth.gr (K.D. Mathiopoulos).Insect Biochemistry and Molecular Biology 38 (2008) 781–787  the catalytic region of AChE is that of the Colorado potato beetle Leptinotarsa decemlineata  (Zhu et al., 1996), in which resistance ishypothesized to be associated with a more generalized change of thesecondary structure of the protein. Finally, there are species, such as Nephotettixcincticeps (Tomitaetal.,2000), Boophilusmicroplus (Baxterand Baker, 1998) and  Lucilia cuprina  (Hughes and Raftos, 1985;Newcomb et al., 1997a), where the OP resistant phenotype is notassociated with alterations in the  ace  gene. For instance, in  L. cuprina OP resistance arises mostly from a mutant form of the carboxylester-aseE3(Newcombetal.,1997b;Campbelletal.,1998).Evidently,there are other mechanisms that also result in OP resistance.The olive fruit fly,  Bactrocera oleae , is the most destructive pestof cultivated olive trees in almost every country where olive treesare cultivated. The damage caused by the oviposition of eggs andtunneling of the emerged larvae in the fruit, results at about 30%loss of the olive crop (Chaniotakis, 1994). The control of the fly isbased mainly on the use of organophosphate insecticides. Earlystudies in the 1970s indicated that overproduction of an AChEallele was associated with resistance of   B. oleae  to dimethoate(Tsakas and Krimbas, 1970; Krimbas and Tsakas, 1971; Tsakas, 1977). More recently, however, it was shown that responsible forsuch resistance, at least in part, were two point mutations in theactive site gorge of AChE of   B. oleae  (Vontas et al., 2002). It wasalso reported that oxidative metabolism (monoxygenase activity)and Est (esterase)-based and/or GST (glutathione S-transferase)-based organophosphate metabolic pathways did not have a majorrole in resistance to OPs (Vontas et al., 2001). Subsequently, it wasshown that both mutations were widespread in several Mediter-ranean countries (Hawkes et al., 2005), although there was noclear correlation between the frequencies of these mutations andthe actual resistance level of the fly populations.Recently, we published a large survey of the resistance statusof   B. oleae  in Greece and Cyprus (Skouras et al., 2007), whereconsiderable variation in the resistance levels was observed. Thiswas mainly attributed to different selection pressures frominsecticidal applications in the various regions. However, themolecular basis of these differences remained unanswered. Thepresent study tries to assess whether these differences can beattributed to differences in the frequencies of the two known  ace mutations (Vontas et al., 2002) or to some additional modifica-tion(s). This search led to the discovery of a new mutation thatassociates with high levels of resistance. Curiously, this mutationlies outside the active site gorge of AChE and indicates that thecarboxyl terminal of the enzyme may be involved in a novel OP-resistance mechanism. 2. Materials and methods  2.1. Insects The study was carried out on field-collected olive flies. Flieswere selected from the populations used in a previous study of Skouras et al. (2007) or collected from new locations, as indicatedin the Results. Most flies used in this study had previouslyundergone classical bioassays in order to determine their OPresistance.  2.2. PCR amplification of exons II, III–V, VIII, IX and X  Primers for PCR amplification of the different putative  ace exons were designed based on the known  B. oleae  cDNA sequence(Vontas et al., 2002) (Table 1). Fly genomic DNA was extracted from the abdomen and thorax of individual flies as described byAshburner (1989). PCR was performed in 20 m l reaction volumeand   10ng genomic DNA was used as a template. The amplifica-tion reactions contained a final concentration of 1  Taq buffer,0.2mM of each dNTP,1.5mM MgCl 2 ,10pmol of each primer and 1unit of Taq polymerease (GoTaq TM Promega). All amplificationswere performed under the following conditions: initial denatura-tion at 94 1 C for 4min, followed by 30 cycles consisting of 94 1 C for30s, annealing temperature for 30s and 72 1 C for extension time.This was followed by 7min of final extension. Annealingtemperatures and extension times are described in Table 1.  2.3. Cloning, DNA sequence analysis and data analysis PCR products of the different exons were separated byelectrophoresis on 1.5% agarose gels and appropriate sizefragments were gel extracted using Wizard s SV Gel and PCR Clean-Up System kit (Promega). Purified products were ligatedwith T4 DNA ligase (Fermentas) into  Eco RV-cleaved, T-tailedBluescript II SK(+) plasmid vector and transformed into  E. coli DH5 a  cells, using standard molecular biology techniques (Sam-brook et al., 1989). DNA sequences of recombinant plasmids wereanalyzed using the Omiga software (Oxford Molecular Ltd.) andthe Clustal W software online. The frequencies of the differentalleles ( R  and  S  ) were determined with the use of POPGENEversion 1.32 (Yeh et al., 1999).  2.4. Diagnostic tests Detection of I214V and G488S mutations was performed asdescribed by Hawkes et al. (2005).For the detection of   D 3Q,   10ng genomic DNA was amplifiedin a 20 m l reaction volume with primers Boace10F and Boace10R.The amplification reaction contained a final concentration of 1  Taq buffer, 0.2mM of each dNTP, 1.5mM MgCl 2 , 10pmol of each primer and 1 unit of Taq polymerease (GoTaq TM Promega).Amplification conditions were: initial denaturation at 94 1 C for4min, followed by 30 cycles consisting of denaturation at 94 1 C for30s, annealing at 51 1 C for 30s and extension at 72 1 C for 30s. Thiswas followed by 7min final extension. PCR products wereelectrophoresed in a high resolution 3% MetaPhor agarose gel(FMC) or in a 10% native or denaturing 2-mm-thick acrylamide ARTICLE IN PRESS  Table 1 Oligonucleotide primers and conditions used in PCRsExons of ace gene Product size (bp) Primers PCR conditionsForward Reverse Annealing temp ( 1 C) Extension time (s)Exon II 315 Boace2F TTCGCGTCAATACAGTGTCG Boace2R CTTTCTTGCACACAGGTTGC 55 30Exon III-V a 1666 Boace3F TATTTTCCCGGTTTCTCTGGC Boace5R CGTCTCTGACATTTCCCATC 48 90Exon VIII 142 Boace8F ACTAGCACTTCCCTATGG Boace8R TAACGGCATTCAGCATCC 48 30Exon IX 156 Boace9F CCACAGATGGCGAAGAATGG Boace9R ATCCCCATTTCCGGACTTCG 53 30Exon X 96 Boace10F TGAAGTCAAACCATCATCCG Boace10R GACAGCGCCAACATGAACG 51 30 a Includes introns. E.G. Kakani et al. / Insect Biochemistry and Molecular Biology 38 (2008) 781–787  782  gel. Visualization of the bands in the acrylamide gels was obtainedafter silver staining (Sambrook et al., 1989).  2.5. Biochemical assays Heads from the untreated adults were homogenized in 200 m lof ice-cold homogenization SP buffer (0.1M sodium phosphate,pH 7.4, 0.1% Triton X-100) with a pestle homogenizer. Thehomogenate was centrifuged at 5000  g   for 5min and the super-natant was used as the enzyme source.Acetylcholinesterase activity was measured in the absence andpresence of an OP using acetylthiocholine (ATC) as a substrate,based on the colorimetric method of  Ellman et al. (1961). Theuninhibited (  OP) and inhibited (+OP) AChE reaction mixturescontained the same amount of protein, as determined by theBradford method (with BSA as the standard protein). Reactionswere incubated at 25 1 C for 15min. Individual assays in flat-bottomed 96 well plates were initiated by the addition of the stainsolution (5ml SP buffer, 0.5ml 0.1M ATC and 1.25ml DTNB in50ml volume). The hydrolysis was monitored by the formation of the thiolate dianion of DTNB at 405nm for 10min at intervals of 30s using a Bio-Tek EL808 Ultra Microplate Reader (Bio-TekInstruments, Winooski, VT). Each measurement was replicatedtwo times. The degree of inhibition of AChE activity with OP wasexpressed as a percentage (%) of AChE activity remaining at the10min timed reading. [(D absorbance of the inhibited reaction/Dabsorbance of the uninhibited reaction)  100]. Mean remainingactivity and error bars of the biochemical data were calculatedusing the SPSS program version 13.0. 3. Results  3.1. Frequency of I214V and G488S in Greek and Cypriot populations In a previous study, the resistance level of olive fly populationsfrom Greece and Cyprus to OP insecticides was monitored(Skouras et al., 2007). Resistance ratios ranged between 6.3 and64.4, which demonstrated considerable variation, obviouslyrelated to selective pressure due to OP use. However, we wantedto determine whether this variation correlated with a correspond-ing frequency variation of the two known  ace  mutations (I214Vand G488S) that are related to OP resistance (Vontas et al., 2002)employing the PCR-RFLP assay developed by Hawkes et al. (2005).For this reason, individuals from the above bioassays (Skouras etal., 2007) or more recent ones performed in our laboratory (datanot shown) were divided in three groups of increasing resistance(4–9ng of insecticide per insect, 19–37 and 75–150ng). It shouldbe noted that in classical bioassays about 20 individuals areassayed per dose in order to estimate the LD 50 . Instead, weperformed the mutation assay in the survivors of each dose, sincethose reflected the portion of the population that was resistant inthat particular dose.Despite the difference in resistance among the examinedgroups of insects, the frequencies of the susceptible ( S  ) andresistant ( R ) alleles for the two mutations did not show significantvariation (Table 2). The majority of the flies genotyped werehomozygous for the two mutations (90%) whereas few individualswere heterozygous (Table 2). However, none of the flies and noteven the individuals with the lowest resistance levels exhibitedthe homozygous genotype for the susceptible type (SS) for eitherI214V or G488S mutations.  3.2. Sequencing analysis of ace exons II–V in resistant individuals Since allele frequencies of I214V and G488S seemed uncorre-lated with resistance levels, we set out to analyze the nucleotidesequence of the  ace  locus of   B. oleae  in order to isolate additionalmutations that could be related to high OP-resistance levels. Themost resistant individuals from the Skouras et al. (2007) studywere selected for the analysis.PCR products of exons II–V from 30 flies from the Kentri (Crete)population that were alive at the highest OP dose (150ng) in theSkouras et al. (2007) bioassays, were cloned and their sequenceswere analyzed. Several polymorphisms were detected. All poly-morphisms in exons II–V and VIII–IX resulted in synonymousnucleotide changes except of the known I214V substitution.  3.3. A novel small deletion mutation in exon X  PCR products of exons VIII–X from 10 flies from the Kentri(Crete) population that were alive at the highest OP dose (150ngper insect) in the Skouras et al. (2007) bioassays, were cloned andtheir sequences were analyzed. Several polymorphisms weredetected. All polymorphisms in exons VIII and IX resulted insynonymous nucleotide changes. However, the alignment of theexon X sequences revealed an interesting 9bp deletion (termed D 3Q) in two out of the 10 flies. These 9bp (GCAACAACA)corresponded to nucleotides 1926–1934 of the mature cDNAsequence of   B. oleae  acetylcholinesterase gene(Vontas et al., 2002)and resulted in a deletion of three glutamine residues at positions642–644 (Fig. 1). ARTICLE IN PRESS  Table 2 Allele frequencies of I214V, G488S and  D 3Q in Greece and Cyprus R  allele ng dimethoate perinsect (range)I214V G488S  D 3Q  F  R b R / N  a N  c F  R  R / N N  c F  R  R / N N  c 4–9 0.8950 213/119 SS: 0 0.9076 216/119 SS: 0 0.0061 1/82 SS: 81SR: 25 SR: 22 SR: 1RR: 94 RR: 97 RR: 019–37 0.9227 334/181 SS: 0 0.9144 331/181 SS: 0 0.0355 13/183 SS: 170SR: 28 SR: 31 SR: 13RR: 153 RR: 150 RR: 075–150 0.8529 58/34 SS: 0 0.8529 58/34 SS: 0 0.0847 10/59 SS: 49SR: 10 SR: 10 SR: 10RR: 24 RR: 24 RR: 0 a N   is the total number of individuals tested and  R  is the number of the resistant alleles found in the sample. For a diploid organism, the maximum value for  R  is 2 N  . b F  R   is the frequency of the resistant allele calculated as the ratio  R /2 N  . c Number of individuals of each genotype observed. E.G. Kakani et al. / Insect Biochemistry and Molecular Biology 38 (2008) 781–787   783   3.4. Genetic correlation of   D  3Q with resistance In order to assess the likely importance of the  D 3Q mutation inconferring OP resistance, the frequency of the mutant allele wasmonitored in similar groups of flies, as described above. In order toachieve this, a direct PCR diagnostic test was used: The designedprimers for exon X PCR used above (Boace10F and Boace10R) allowthe amplification of almost the entire exon X, which contains the9bp deletion.Thus,PCRof thewild-typealleleyieldsa 96bp productwhereas PCR of the mutant allele yields an 87bp product due to thementioned deletion. The difference between the wild-type and themutant PCR products can be visualized after electrophoresis in ahigh resolution 3% MetaPhor (FMC) agarose gel (data not shown) orin a 10% native or denaturing acrylamide gel (Fig. 2).As shown inTable 2, the frequency of the mutant allele showeda significant correlation with OP-resistance levels. Interestingly,the  R  allele was always found in heterozygosis.  3.5. Biochemical correlation of   D  3Q with resistance In order to confirm the correlation of the new mutation withthe OP resistance at the individual level, acetylcholinesteraseremaining activity was assayed in field-collected flies. For thispurpose, flies collected from the Chania region of Crete this yearwere genotyped with regard the three  ace  mutations (I214V,G488S and  D 3Q). At the same time, AChE remaining activity wasassayed from the heads of the same flies. As Fig. 3 illustrates, thepresence of one  D 3Q allele either in the I214V +/  , G488S +/  orI214V  /  , G488S  /  genotypes increased AChE remaining activityby 44% and 14%, respectively. In addition, the expression of the  ace gene was also measured in the same individuals and was shownunaffected (data not shown). 4. Discussion The resistance status of   B. oleae  in Greece and Cyprus wasrecently examined (Skouras et al., 2007) and considerablevariation in the resistance levels to dimethoate was recorded.Resistance ratios ranged from 6.3 to 64.4 (compared to alaboratory susceptible strain). The highest resistance ratios werefound in populations from Crete, and the lowest in those fromCyprus. This variation was mainly attributed to different selectionpressures from insecticidal applications among populations fromthe various regions. However, the molecular basis of this variationremained unanswered. Two mutations (I214V and G488S),localized in the catalytic gorge of acetylcholinesterase of   B. oleae ,are known to confer resistance to organophosphate insecticides(Vontas et al., 2002). If these two mutations were the onlycontributors to resistance, one should expect that their frequencyin a natural population would vary according to the resistancelevel of the population. In view of that, the frequencies of the twomutations in individuals with increasing resistance were esti-mated. Both mutations were observed almost in homozygocity atabout 90% of the samples (Table 2). However, there was nofrequency variation and therefore no correlation between muta-tion frequencies and resistance level (Table 2). Consequently,there must be other contributing factors to the variation of resistance, such as other mutations in the  ace  gene or theinvolvement of other loci. In this study, the presence of additionalmutations in the  ace  gene of the most resistant insects of theSkouras et al. (2007) study was investigated.At least 14 different mutations have been described that residein and around the active site gorge of the  ace  gene that conferresistance in different insects (Fournier, 2005). Most of thesemutations are conserved in several species, despite the widelydiffering sizes and structures of OP insecticides. There are at leasttwo reasons that may account for this. One may be due to thenecessity for resistance targets to maintain their wild-typefunctions and to the fitness cost some of these mutations maycarry (Mutero et al.,1994). The second may relate to the fact that,because of the enzyme similarity among species, there are alimited (and always the same) number of residues that interactwith the insecticide and could therefore be targets for mutagen-esis (ffrench-Constant et al., 1998). Perhaps these resistance-associated mutations have little effect on normal enzyme functionand can be readily maintained in natural populations. In fact,resistance to malathion was detected in pinned specimens of Australian sheep blow-flies that were collected prior to theintroduction of the insecticide, which suggests that resistancealleles pre-existed at sufficient frequencies without imposing afitness cost in the natural population (Hartley et al., 2006). It wastherefore sensible to expect more mutations in the  ace  gene of  B. oleae  that would contribute to OP resistance than the twoknown ones.However, the search for new mutations in the exons thatencompass the active site gorge (i.e., exons II–VI) yielded nothingbut silent nucleotide substitutions. This maybe due tothe fact thatthe olive fly, even though it has been consistently controlled withOP insecticides the last 40 years both in Greece and Cyprus, has ARTICLE IN PRESS Fig.1.  Diagrammatic representation of the PCR product of   B. oleae ace  exon 10. Primers Boace10Fand Boace10R (indicated at the 5 0 end and 3 0 end, respectively) are the twoprimers used for the amplification of the entire fragment. Fig. 2.  Direct PCR analysis of the  D 3Qin a 10% native acrylamide gel. The  RR  lane isthe amplification product of the cloned  D 3Q allele in a plasmid vector andrepresents a hypothetical  D 3Q   /  genotype. The  RS   and  S  S lanes are amplificationproducts of filed-collected flies of   D 3Q   /+ and  D 3Q  +/+ genotypes, respectively. Therightmost lane, indicated  M  , is the molecular weight marker. E.G. Kakani et al. / Insect Biochemistry and Molecular Biology 38 (2008) 781–787  784  encountered a limited variety of them, that is fenthion anddimethoate. Therefore, the two mutations observed maybe thebest combination that confers lowest fitness cost and highestresistance to the two OPs used against olive fly populations. Itmay be that the larger number of   ace  mutations acquired by otherinsects is due to their exposure to a larger variety of OPs and CBs.In fact,  in vitro  expression of mutated proteins that containedseveral OP-associated mutations at the same protein bothincreased the resistance level and provided a wide spectrum of resistance (Menozzi et al., 2004). Alternatively, it could be that theactive site gorge of   B. oleae ’s  ace  gene is saturated with I214V andG488S and any more mutations would hamper normal AChEfunction and greatly affect the fitness of the fly.Contrary to our expectation, however, the search in exonsVIII–X led to the discovery of a new mutation that lied in theputative exon X of the  ace  gene. This mutation was a shortdeletion of nine nucleotides (nucleotides 1926–1934 of themature cDNA sequence of   B. oleae ’s  ace  gene (Vontas et al.,2002)) that corresponded to the deletion of three glutamineresidues (at positions 642–644) (Fig.1). This deletion was initiallyobserved in two out of the 10 most resistant individuals that werealive at the highest OP doses in the Skouras et al. (2007) bioassays.It was essential to determine whether this mutation was aneutral allele of AChE found in Cretan flies or, rather, a resistance-associated one. For this reason a direct PCR assay was used thatcould easily monitor the presence of the new mutation in thefield. Firstly, a few individuals from mainland Greece and Cypruswere tested for the presence of   D 3Q where it was readily found(data notshown). This made clear that  D 3Q was not a Cretan alleleand, therefore, its presence could have been a result of the insect’sadaptation to a particular selective pressure, such as insecticides.Secondly, the likely importance of the  D 3Q mutation in conferringOP resistance was assessed. For this, the frequency of the  D 3Q mutation was determined in samples of different levels of resistance. Such samples were formed by the survivors of thedifferent doses used in the bioassays of the Skouras et al. (2007)study or more recent ones, since those reflected the portion of thepopulation that was resistant in that particular dose. As evidencedin Table 2, the frequency of the  D 3Q allele showed a significantcorrelation with OP-resistance levels.In addition, biochemical studies were conducted in order toevaluate the contribution of the  D 3Q mutation in the resistance.Acetylcholinesterase activity of field-collected flies of knowngenotypes for the three mutations (I214V, G488S and  D 3Q) wasassayed. Results demonstrated that the presence of one  D 3Q alleleeither in the I214V +/  , G488S +/  or I214V  /  , G488S  /  genotypesincreased AChE remaining activity by 44% and 14%, respectively(Fig. 3). At the same time, the expression of the  ace  gene remainedunaffected (data not shown).Two major conclusions can be drawn from these data. Firstly,mutations I214V and G488S are the first ones to be selected underthe minimum OP pressure. In fact, as mentioned earlier, none of the flies tested, not even the individuals that demonstrated thelowest resistance level, exhibited the homozygous genotype of thesusceptible type (SS) for mutations I214V or G488S (i.e., I214V +/+ ,G488S +/+ ). This advocates for a low fitness cost of the twomutations and for their importance at a minimum level of resistance. On the contrary, the  D 3Q mutation appears associatedwith resistance at higher OP doses and, possibly under a differentmechanism other than the steric alteration of the activesite residues of AChE. Apparently, the fitness cost of   D 3Q maybe much higher, as also suggested by the fact that the  R allele was always found in heterozygosis. However, it should beemphasized that by no means do we claim that  D 3Q is the onlycontributor to high-resistance levels. In fact, the low-frequencylevel of   D 3Q, even in the highest resistance group (8.5%, Table 2),points to more contributing factors for the high OP resistanceof   B. oleae . ARTICLE IN PRESS Fig. 3.  AChE remaining activity(afterdimethoate inhibition) of different genotypes containing different combinations of the three mutations (I214V, G488S and  D 3Q) in the ace  gene. Inside the columns are indicated the mean remaining activity and the number of individuals assayed ( N  ). The error bars at the top of the columns indicate thestandard deviation. E.G. Kakani et al. / Insect Biochemistry and Molecular Biology 38 (2008) 781–787   785

Obs

Mar 17, 2018
Search
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks