Economy & Finance

A variant affecting miRNAs binding in the circadian gene Neuronal PAS domain protein 2 (NPAS2) is not associated with breast cancer risk

Description
A variant affecting miRNAs binding in the circadian gene Neuronal PAS domain protein 2 (NPAS2) is not associated with breast cancer risk
Published
of 7
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  EPIDEMIOLOGY A variant affecting miRNAs binding in the circadian geneNeuronal PAS domain protein 2 (  NPAS2 ) is not associatedwith breast cancer risk Furu Wang  • Zhibin Hu  • Rongxi Yang  • Jinhai Tang  • Yao Liu  • Kari Hemminki  • Christian Sutter  • Barbara Wappenschmidt  • Dieter Niederacher  • Norbert Arnold  • Alfons Meindl  • Claus R. Bartram  • Rita K. Schmutzler  • Barbara Burwinkel  • Hongbing Shen Received: 12 February 2010/Accepted: 27 August 2010/Published online: 8 December 2010   Springer Science+Business Media, LLC. 2010 Abstract  Disruption of the circadian rhythm has beenreported to increase the risk of breast cancer. A singlenucleotide polymorphism (SNP) rs2305160 in NeuronalPAS domain protein 2 (  NPAS2 ), the largest circadian gene,was identified as a breast cancer susceptibility locus. In thecurrent study, we found a novel functional SNP (rs3739008)located at 3 0 UTR of   NPAS2  and the C to T changing of theSNP may disrupt the binding of microRNA- (miR-) 17-5pand miR-519e to the 3 0 UTR of   NPAS2 . We then typed thisSNP in case–control studies of both Chinese and Germanypopulations to test its putative associations with breastcancer risk. However, we failed to find any significantassociations by different genetic models (dominant geneticmodel, adjusted OR = 1.13, 95% CI = 0.95–1.35 for theChinese population and adjusted OR = 0.99, 95% CI =0.85–1.16 for the Germany population). Although we didnot find significant associations at population levels fromboth Chinese and Germany case–control studies, due to the Furu Wang, Zhibin Hu, and Rongxi Yang Contributed equally to thisstudy.F. Wang    Z. Hu    Y. Liu    H. Shen ( & )Laboratory of Reproductive Medicine, Cancer Center, NanjingMedical University, 140 Hanzhong Road, Nanjing 210029,Chinae-mail: hbshen@njmu.edu.cnZ. Hu    R. Yang    B. BurwinkelHelmholtz-University Group Molecular Epidemiology, GermanCancer Research Center (DKFZ), Im Neuenheimer Feld 581,69120 Heidelberg, Germanye-mail: B.Burwinkel@dkfz-heidelberg.deZ. Hu    R. Yang    B. BurwinkelDivision Molecular Biology of Breast Cancer, Departmentof Gynecology and Obstetrics, University of Heidelberg,69115 Heidelberg, GermanyJ. TangDepartment of General Surgery, Jiangsu Cancer Hospital,Nanjing 210009, ChinaK. HemminkiDivision of Molecular Genetic Epidemiology, GermanCancer Research Center (DKFZ), Im Neuenheimer Feld 580,69120 Heidelberg, GermanyK. HemminkiDepartment of Biosciences at Novum, Karolinska Institute,14157 Huddinge, SwedenC. Sutter    C. R. BartramInstitute of Human Genetics, University of Heidelberg,69120 Heidelberg, GermanyB. Wappenschmidt    R. K. SchmutzlerDivision of Molecular Gynaeco-Oncology, Departmentof Gynaecology and Obstetrics, Clinical Center Universityof Cologne, 50931 Cologne, GermanyD. NiederacherDivision of Molecular Genetics, Department of Gynaecologyand Obstetrics, Clinical Center University of Du¨sseldorf,40225 Du¨sseldorf, GermanyN. ArnoldDivision of Oncology, Department of Gynaecologyand Obstetrics, University Hospital Schleswig-Holstein,24105 Kiel, GermanyA. MeindlDepartment of Gynaecology and Obstetrics, Klinikum rechtsder Isar, Technical University of Munich, 81675 Munich,Germany  1 3 Breast Cancer Res Treat (2011) 127:769–775DOI 10.1007/s10549-010-1157-8  functional relevance of rs3739008 on  NASP2  expression, itwill be promising to investigate the influence of this varianton clinical characteristics of breast cancer and breast cancersurvival. Keywords  NPAS2    miRNAs    SNPs    Breast cancer   Molecular epidemiology Abbreviations  NPAS2  Neuronal PAS domain protein 2SNPs single nucleotide polymorphismsUTR untranslated regionmiRNAs microRNAsOR odds-ratioCI confidence interval Introduction Disruption of the circadian rhythm has been reported toincrease the risk of breast cancer in several epidemiologicstudies that involved women working in night shifts [1–3]. These findings suggest a role of circadian rhythms in breasttumsrcenesis and lead to the circadian gene hypothesis,which states that genes responsible for maintaining circa-dian rhythms might act as a panel of candidates as breastcancer suppressors [4]. The hypothesis is supported byemerging data from animal models that demonstrate asubstantial impact of circadian genes on several tumor-related biological pathways such as cell proliferation, cellcycle control, apoptosis, and DNA damage response [5].However, only one study has tested this hypothesis amongbreast cancer populations [6].Neuronal PAS domain protein 2 (  NPAS2 ), the largestcircadian gene, maps on chromosome 2 at 2q11.2 andspans 177 kb. It is expressed primarily in the mammalianforebrain and encodes for a member of the basic helix-loop-helix-PAS class of transcription factors by binding tothe E-box element (CANNTG) in the promoter of its targetgenes.  NPAS2  forms heterodimers with  BMAL1  and thentranscriptionally activates expression of two other circadiangenes,  PER  and  CRY  , which are required for maintainingbiological rhythms in many organisms [7, 8]. Previous evidence has suggested that deficiency in  NPAS2  leads todecreased oscillation of other circadian genes, and loss of normal  NPAS2  may cause defects in several aspects of thecircadian system, such as patterns of sleep and behavior [9,10]. Moreover,  NPAS2  has been suggested to be involvedin tumsrcenesis, by regulating  PER2 , a newly character-ized tumor suppressor [5, 11], and the oncogene c-myc to suppress its transcription [11]. Now, more and more datasupport that  NPAS2  is a putative tumor suppressor, playingan important role in DNA damage response and cell cyclecontrol by activating different downstream genes [12–14]. Recently, Zhu et al .  [6] reported an association of a non-synonymous SNP rs2305160 in exon 13 of   NPAS2 with risk for breast cancer by a case–control study of 431 cases and476 controls of Causation srcin, suggesting that geneticvariations in  NPAS2  might be candidate biomarkers forbreast cancer risk. In addition, the same group also reportedthat rs2305160 may borderline significantly related tobreastcancer survival, where as NPAS2 expression is a signifi-cant biomarker for breast cancer survival [15]. As NPAS2is a trans-activator to control the expression of downstreamtumor-related genes, we searched potentially functionalSNPs in the promoter region, 5 0 -untranslated region (UTR)and3 0 UTR,whichmayinfluencegeneexpression,andfounda putative functional SNP (rs3739008) located at 3 0 UTR of   NPAS2 . The C to T changing of the SNP may disrupt thebinding of several microRNAs (miRNAs) to the 3 0 UTR of   NPAS2 ,includingmembersofthemiR-17-5p,miR-20b,andmiR-519e (http://www.mirbase.org/ ).miRNAs are a class of small, noncoding regulatoryRNAs that regulate gene expression by complementary basepairing with the 3 0 UTR of target mRNAs and causing theirdegradation or suppressing mRNA translation [16, 17]. We have reported that common SNPs in both pre-miRNAs andputative miRNA target sites may contribute to breast cancersusceptibility [18, 19]. Therefore, in the current study, we first verified that the rs3739008 SNP located at 3 0 UTR of   NPAS2  truly affects the binding of miRNAs and then typedthis SNP in case–control studies of both Chinese and Ger-many populations to test its putative association with breastcancer risk. Materials and methods Study populationsThe two hospital-based case–control studies have beendescribed previously [20, 21] and approved by the insti- tutional review board of Nanjing Medical University andthe Ethics Committee of the University of Heidelberg,respectively. In brief, for the Chinese breast cancer study,1006 incident breast cancer cases and 1017 cancer-freecontrols were genotyped in the current study. All the breastcancer cases were newly diagnosed and histopathologicallyconfirmed. Cancer-free control women were frequency-matched to the cases on age ( ± 5 years) and residential area(urban or rural). All the participants were geneticallyunrelated, ethnic Han Chinese women. For the study of theGerman Consortium of Hereditary Breast and OvarianCancer (GC-HBOC), genotyping analyses were performedon genomic DNA of   BRCA1/2  mutation-negative index 770 Breast Cancer Res Treat (2011) 127:769–775  1 3  patients from 1139 German breast cancer families and1411 unrelated German controls. The control populationincluded healthy and unrelated female blood donors,sharing the ethnic background and sex with the breastcancer patients. The age distribution in the controls andcases was nearly identical (controls: mean age 45.9 years;cases: mean age 46.0 years).Genotyping assaysThe PCR-RFLP assay was used to genotype the rs3739008SNP for Chinese samples. The primers were 5 0 -TAGGCATCGTCGGTCGGTTTG-3 0 (sense) and 5 0 -GGGCTGCTGTTGTTACTGTGGTCT-3 0 (antisense). A 333-bp PCRproduct was digested by Rsa I (New England BioLabs,Beverly, MA) and the C allele resulted in two bands(273 bp and 60 bp), while the T allele three bands (200 bp,73 bp, and 60 bp). TaqMan allelic discrimination assaywas used to genotype the Germany samples. Primers andTaqMan probes were 5 0 -ATTTGCACAGCTACACA-GAGGAA-3 0 (sense), 5 0 -TTGGTGGGCTGCTGTTGTTA-3 0 (antisense) and CAGAAAGTGCCTAAGTTA (VIC),AAACAGAAAGTACCTAAGTTA (FAM) (Applied Bio-systems Foster City, CA). Ten percent of the samples wererandomly selected for repeated assays. The concordancerate was [ 99%.Construction of miRNA expression vectors and  NPAS2 3 0 UTR report geneThreefragmentscontainingmiRNAs(miR-17-5p,miR-20b,and miR-519e) sequences were amplified from a sampleDNA and then cloned into the pcDNA3.1 (Invitrogen,Carlsbad, CA) vector with  BamH   I and  Hind   III digestions.The primers for each miRNAs were listed in Table 1. The1244-bp 3 0 UTR region of   NPAS2  containing the putativers3739008 recognition site was amplified from the sampleDNA carried CC genotype and then cloned into the pMIR-REPORT TM (Applied Biosystems) vector with  Mlu  I and  Hind  IIIdigestions.Theprimerswere:5 0 -GTAGACGCGTCAGCTTTAACCAATGGATGAG-3 0 (sense) and 5 0 -TCCAAAGCTTTGGGAAAAGGAACTGGTATC-3 0 (antisense).The report gene containing rs3739008 TT genotype wasobtained by site-directed mutagenesis method. All theinsertions were sequenced to verify the accuracy.Transient transfections and luciferase assaysTwo sets of transfections were performed with MCF-7,Hela, and A549 cell line for each miRNA using Lipofectaccording to the manufacturer’s recommendations (Invit-rogen). One set was the  NPAS2  3 0 UTR luciferase reporterplasmids (different alleles) and chemically synthesizedmature miRNAs (miR-17-5p, miR-20b, or miR-519e), andthe other was the  NPAS2  3 0 UTR luciferase reporter plas-mids (different alleles) and miRNAs expression plasmids(miR-17-5p, miR-20b, or miR-519e). Each set was cotrans-fected with pRL-SV40 plasmids (Promega, Madison, CA)as a normalizing control. All the transfections were carriedout in triplicate. After 24 h of incubation, cells were col-lected and analyzed for luciferase activity with the Dual-Luciferase Reporter Assay System (Promega).Statistical analysesDifferences in frequencies of the genotypes of the  NPAS2 rs3739008 variant between the cases and controls wereevaluated by using the  v 2 test. The associations betweenrs3739008 genotypes and the risk of breast cancer wereestimated by computing the odds ratios (ORs) and their95% confidence intervals (CIs) from logistic regressionanalyses with the adjustment for age. Hardy–Weinbergequilibrium was tested by a goodness-of-fit  v 2 test tocompare the observed genotype frequencies to the expectedones. All of the statistical analyses were performed withStatistical Analysis System software (9.1.3; SAS Institute,Cary, NC, USA). Results To evaluate the influence of the rs3739008 variant on thebinding of miR-17-5p, miR-20b, and miR-519e to the3 0 UTR of   NPAS2 , we generated  NPAS2  3 0 UTR reportergene (C or T allele) that was cotransfected with miRNA Table 1  Primary informationon construction of miRNAexpression vectorsmiRNAs Amplification PCR primer PCR product (bp)miR-17-5p 5 0 -GCGCGGATCCATACGTGTCTAAATGGACCTC-3 0 (sense) 4515 0 -TCCAAAGCTTCCTATATACTTGCTTGGCTTG-3 0 (antisense)miR-519e 5 0 -GCGCGGATCCTTGAAGCAAGGAACTGGAG-3 0 (sense) 4185 0 -TCCAAAGCTTGGACCAACTAGCCTAAGAGG-3 0 (antisense)miR-20b 5 0 -CGCGGATCCATACGCATGAAGGTGTGTTC-3 0 (sense) 4105 0 -TCCAAAGCTTACAGGCTGCCTAATATACAG-3 0 (antisense)Breast Cancer Res Treat (2011) 127:769–775 771  1 3  expression plasmids (miR-17-5p, miR-20b, or miR-519e) orchemically synthesized mature miRNAs (miR-17-5p, miR-20b, or miR-519e) in MCF-7, Hela, and A549 cell lines.pRL-SV40 plasmids were used to normalize the trans-fections. As shown in Fig. 1, significant lower levels of luciferase expression were observed consistently for thereport gene carrying rs3739008C allele, when we cotrans-fected with the miR-17-5p or miR-519e miRNA expressionplasmids, or chemically synthesized mature miR-17-5p ormiR-519e in all the three cell lines (Fig. 1a, miR-17-5pvector in MCF-7 cell line: 0.541  ±  0.108 for the C allele vs.0.838  ±  0.197 for the T allele,  P  =  0.002; miR-519e vec-tor in MCF-7 cell line: 0.577  ±  0.121 for C vs. 0.828  ± 0.136 for T,  P  =  0.001; Fig. 1b, miR-17-5p probe in MCF-7 cell line: 0.341  ±  0.182 for C vs. 0.622  ±  0.167 for T, P  =  0.004; miR-519e probe in MCF-7 cell line:0.373  ±  0.068 for C vs. 0.680  ±  0.158 for T,  P \ 0.0001;Fig. 1c, miR-17-5p vector in Hela cell line: 2.408  ±  2.164for C vs. 3.928  ±  3.610 for T, P  =  0.040; miR-519e vectorin Hela cell line: 2.179  ±  2.037 for C vs. 3.256  ±  2.334 forT,  P  =  0.011; Fig. 1d, miR-17-5p probe in Hela cell line:1.933  ±  1.077 for C vs. 3.057  ±  1.210 for T,  P  =  0.001;miR-519e probe in Hela cell line: 2.494  ±  0.459 for C vs.4.275  ±  1.398 for T, P  =  0.006; Fig. 1e, miR-17-5p vectorin A549 cell line: 0.972  ±  0.335 for the C allele vs.1.213  ±  0.386 for the T allele,  P  =  0.012; miR-519e vec-tor in A549 cell line: 1.387  ±  0.645 for C vs. 1.503  ± 0.640 for T,  P  =  0.002; Fig. 1f, miR-17-5p probe inA549 cell line: 0.731  ±  0.564 for C vs. 1.053  ±  0.660for T,  P  =  0.012; miR-519e probe in A549 cell line: miR-17-5p miR-519e miR-20b miR-17-5p miR-519e miR-20b miR-17-5p miR-519e miR-20b miR-17-5p miR-519e miR-20b miR-17-5p miR-519e miR-20b miR-17-5p miR-519e miR-20b 0.0 0.2 0.4 0.6 0.8 1.0  P  =0.002  P  =0.001  P  =0.608 A    R  e   l  a   t   i  v  e   L  u  c   i   f  e  r  a  s  e  e  x  p  r  e  s  s   i  o  n   i  n   M   C   F  -   7 0.0 0.2 0.4 0.6 0.8  B  P  =0.004  P  <0.0001  P  =0.134    R  e   l  a   t   i  v  e   l  u  c   i   f  e  r  a  s  e  e  x  p  r  e  s  s   i  o  n   i  n   M   C   F  -   7 0 12 3 4 5 6  C  P  =0.040  P  =0.011  P  =0.136    R  e   l  a   t   i  v  e   L  u  c   i   f  e  r  a  s  e  e  x  p  r  e  s  s   i  o  n   i  n   H  e   l  a 0 12 3 4 5 6  D  P  =0.001  P  =0.006  P  =0.145    R  e   l  a   t   i  v  e   L  u  c   i   f  e  r  a  s  e  e  x  p  r  e  s  s   i  o  n   i  n   H  e   l  a 0 12  E  P  =0.012  P  =0.002  P  =0.007    R  e   l  a   t   i  v  e   L  u  c   i   f  e  r  a  s  e  e  x  p  r  e  s  s   i  o  n   i  n   A   5   4   9 0.0 0.5 1.0 1.5  F  P  =0.012  P  =0.003  P  =0.001    R  e   l  a   t   i  v  e   L  u  c   i   f  e  r  a  s  e  e  x  p  r  e  s  s   i  o  n   i  n   A   5   4   9 Fig. 1  In vitro target bindingassays for rs3739008C/T inMCF-7, Hela, and A549 celllines. Each transfection wasperformed with pRL-SV40plasmids as normalizingcontrols. Data presented are themean fold increase  ± SD fromthree independent transfectionexperiments, and each was donein triplicate.  a  NPAS2  3 0 UTRluciferase reporter plasmids(C allele or T allele) withmiRNAs expression plasmids inMCF-7 cell lines.  b  NPAS2 3 0 UTR luciferase reporterplasmids (C allele or T allele)with chemically synthesizedmature miRNA in MCF-7 celllines.  c  NPAS2  3 0 UTRluciferase reporter plasmids(C allele or T allele) withmiRNAs expression plasmids inHela cell lines.  d  NPAS2  3 0 UTRluciferase reporter plasmids(C allele or T allele) withchemically synthesized maturemiRNA in Hela cell lines. e  NPAS2  3 0 UTR luciferasereporter plasmids (C allele or Tallele) with miRNAs expressionplasmids in A549 cell lines. f   NPAS2  3 0 UTR luciferasereporter plasmids (C allele or Tallele) with chemicallysynthesized mature miRNA inA549 cell lines772 Breast Cancer Res Treat (2011) 127:769–775  1 3  0.652  ±  0.428 for C vs. 0.971  ±  0.560 for T,  P  =  0.003).However, although cotransfected expression plasmid orsynthesized mature miRNA of miR-20b could also downregulate the luciferase expression of the  NPAS2  3 0 UTRreport gene in all three cell lines, the expressions presenteda little disagreement in each cell line according to thers3739008 SNP (Fig. 1a, miR-20b vector in MCF-7 cellline: 0.658  ±  0.133 for the C allele vs. 0.690  ±  0.125 forthe T allele,  P  =  0.608; Fig. 1b, miR-20b probe in MCF-7cell line: 0.479  ±  0.130 for C vs. 0.579  ±  0.138 for T, P  =  0.134; Fig. 1c, miR-20b vector in Hela cell line:1.449  ±  0.722 for the C allele vs. 1.914  ±  1.512 for the Tallele,  P  =  0.136; Fig. 1d, miR-20b probe in Hela cell line:2.517  ±  1.322 for C vs. 3.269  ±  1.572 for T,  P  =  0.145;Fig. 1e, miR-20b vector in A549 cell line: 0.729  ±  0.382for the C allele vs. 0.969  ±  0.466 for the T allele, P  =  0.007; Fig. 1f, miR-20b probe in A549 cell line:0.635  ±  0.420 for C vs. 0.891  ±  0.402 for T,  P  =  0.001).In the association studies, our observed genotype fre-quencies for rs3739008 were in agreement with Hardy–Weinberg equilibrium in the controls and in the cases of both populations ( P  =  0.542 in the controls and  P  =  0.650in the cases for the Chinese population and  P  =  0.359 inthe controls and  P  =  0.318 in the cases for the Germanpopulation). As shown in Table 2, multivariate logisticregression analyses showed that no significant associationswere observed for different genetic models considered inboth Chinese and Germany studies (in the dominantgenetic model, adjusted OR  =  1.13, 95% CI  =  0.95–1.35for the Chinese population and adjusted OR  =  0.99, 95%CI  =  0.85–1.16 for the Germany population). Discussion Epidemiological studies have revealed a role for the cir-cadian clock in human breast cancer development [1–3, 22, 23]. These carefully designed studies showed that disrup-tion of circadian cycles, such as in people that work pre-dominantly at night, is a risk factor for breast cancerdevelopment. The breast cancer risk increased with thenumber of years or number of hours per week that indi-viduals spent working at night. Recently, a large amount of in vivo evidence has shown that the circadian clock isinvolved in tumor suppression at the systemic, cellular, andmolecular levels through its involvement in cell prolif-eration, apoptosis, cell cycle control, and DNA damageresponse [5].The transcription factor NPAS2 is one of nine humancore circadian genes that influence a variety of biologicalprocesses by regulating the 24-h circadian rhythm, and alsotumorigenesis [5, 11–14]. Two genetic association studies have shown that a missense polymorphism in NPAS2,rs2305160, is significantly associated with risk of breastcancer and non-Hodgkin’s lymphoma [6, 24]. However, using the current study population from China, we did notobserve the association between rs2305160 and breastcancer development (variant T allele frequency: 0.230 inthe cases and 0.236 in the controls,  P  =  0.683; adjustedOR  =  0.99, 95% CI  =  0.83–1.18 in the dominant geneticmodel).To estimate the statistical power of our current study, weconducted Power Calculation for rs3739008 (PS, Powerand Sample Size Calculations version 1.0.17). Our study Table 2  Logistic regression analyses on associations between  NPAS2  rs3739008 and risk of breast cancerrs3739008 (C [ T) Cases  N   (%) Controls  N   (%)  P  Crude OR (95% CI) Adjusted OR (95% CI) a NJMU 1006 1017CC 595 (59.15) 631 (62.05) 0.382 b 1.00 1.00CT 354 (35.19) 336 (33.04) 1.13 (0.93–1.37) 1.12 (0.93–1.35)TT 57 (5.67) 50 (4.92) 0.167 c 1.24 (0.83–1.86) 1.21 (0.81–1.80)T allele frequency 0.233 0.214 0.174 d CT  ?  TT 411 (40.85) 386 (37.95) 1.13 (0.95–1.35) 1.13 (0.95–1.35)GC-HBOC 1139 1411CC 538 (47.23) 662 (46.92) 0.978 b 1.00 1.00CT 478 (41.97) 598 (42.38) 0.98 (0.83–1.16) 0.99 (0.83–1.16)TT 123 (10.80) 151 (10.70) 0.934 c 1.00 (0.77–1.31) 1.00 (0.77–1.31)T allele frequency 0.318 0.319 0.933 d CT  ?  TT 601 (52.77) 749 (53.08) 0.99 (0.84–1.16) 0.99 (0.85–1.16) a Adjusted for age b Two-sided  v 2 test for difference in frequency distribution of genotypes between cases and controls c P  trend for genotypes between cases and controls d Two-sided  v 2 test for difference in frequency distribution of alleles between cases and controlsBreast Cancer Res Treat (2011) 127:769–775 773  1 3
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks