Environment

Absence of follicle-stimulating hormone receptor activating mutations in women with iatrogenic ovarian hyperstimulation syndrome

Description
Absence of follicle-stimulating hormone receptor activating mutations in women with iatrogenic ovarian hyperstimulation syndrome
Categories
Published
of 5
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  Absence of follicle-stimulating hormone receptoractivating mutations in women with iatrogenic ovarianhyperstimulation syndrome Catarina Brasil d’Alva, M.D., a Paulo Serafini, M.D., b  Eduardo Motta, M.D., b  Maria Beatriz da Fonte Kohek, Ph.D., c  Ana Claudia Latronico, M.D., a and  Berenice Bilharinho Mendonca, M.D. a a Unidade de Endocrinologia do Desenvolvimento, Laboratorio de Hormonios e Genetica Molecular LIM/42, Disciplina deEndocrinologia, Hospital das Clinicas, Universidade de São Paulo, São Paulo;  b Huntington Centro de Medicina Reprodutiva,São Paulo SP; and  c Departamento de Ciencias Fisiologicas, Fundacao Faculdade de Ciencias Medicas de Porto Alegre, PortoAlegre, RS, Brazil Objective:  To analyze the FSH receptor gene in women with iatrogenic ovarian hyperstimulation syndrome(OHSS). Design:  Clinical and molecular studies. Setting:  University hospital and private clinic. Patient(s):  Twenty-nine women who developed moderate or severe OHSS after ovulation induction for IVF. Inaddition, 50 fertile normal women were used as controls. Intervention(s):  Peripheral blood was used for DNA extraction. The exons 4, 7, 9, and 10 of the FSH receptorgene were amplified by polymerase chain reaction (PCR) followed by automatic direct sequencing. Main Outcome Measure(s):  Hormonal results and automatic sequencing analysis. Result(s):  Thirteen patients developed moderate OHSS and 16 patients developed the severe form of thesyndrome. Automatic sequencing revealed no activating mutations in all patients studied. We found two knownpolymorphisms in linkage disequilibrium, Ala307Thr and Ser680Asn, in 79.3% of the patients (44.8% inheterozygous and 34.5% in homozygous state). These polymorphisms were found with similar frequency in the50 normal fertile women. Conclusion(s):  We conclude that the FSH receptor genotype did not play a significant role in the risk of iatrogenicOHSS in this cohort. (Fertil Steril   2005;83:1695–9. ©2005 by American Society for Reproductive Medicine.) Key Words:  FSH receptor, ovarian hyperstimulation syndrome, polymorphisms Ovarian hyperstimulation syndrome (OHSS) can occurspontaneously during early pregnancy or as an iatrogeniccomplication after exogenous gonadotropin administrationin assisted reproductive medicine (1). Although the iatro- genic form is relatively common, the incidence of severecases ranges from 0.5% to 5% (2). In contrast, the sponta- neous form, also known as hyperreaction luteinalis of thefirst trimester, is a very rare condition and has been associ-ated with overproduction of endogenous hCG (3).Both the spontaneous and iatrogenic forms are character-ized by the presence of multiple serous and hemorrhagicfollicular cysts along with clinical features varying fromabdominal distention and discomfort to potentially threaten-ing, massive ovarian enlargement and capillary leak withfluid sequestration in the third space. Oliguria, renal failure,hypovolemic shock, thromboembolic phenomena, and adultdistress syndrome show the lethal potential of this condition(1). Recently, three distinct activating mutations of the FSHreceptor gene were described in three women with the spon-taneous form of OHSS, indicating that the FSH receptorgenotype has a role in the pathophysiology of this syndrome(4–6). All patients were heterozygous for mutations in theexon 10 that encodes the transmembrane domain. Functionalcharacterization of the mutated receptors revealed promiscu-ous activation of the FSH receptor by hCG (4–6). These studies indicated that inappropriate stimulation of the FSH Received July 22, 2004; revised and accepted December 13, 2004.Partially supported by grants from Fundacao de Amparo a Pesquisa doEstado de São Paulo (03/10874-6) and Conselho Nacional de Desen-volvimentoCientificoeTecnologico(ACL300151/96andBBM301246/ 95-5).Reprintrequests:BereniceB.Mendonca,M.D.,HospitaldasClinicas,Labo-ratorio de Hormonios e Genetica Molecular LIM/42, Av. Dr. Eneas deCarvalho Aguiar, 155, 2° andar, Bloco 6, CEP 05403-900, São Paulo-SP,Brazil (FAX: 55-11-30830626; E-mail: cbdalva@terra.com.br). OVULATION INDUCTION 1695 0015-0282/05/$30.00 Fertility and Sterility   Vol. 83, No. 6, June 2005doi:10.1016/j.fertnstert.2004.12.044 Copyright ©2005 American Society for Reproductive Medicine, Published by Elsevier Inc.  receptor represents a key element in the development of recurrent spontaneous OHSS.The pathogenesis of the iatrogenic form of OHSS has notbeen completely elucidated. The excessive follicular recruit-ment secondary to activation of both FSH and LH receptorsby hCG has been a possible explanation for iatrogenic OHSS(4, 6, 7). However, whether polymorphisms or activating mutations of FSH receptor could alter the sensitivity orspecificity of the receptor and justify some of the iatrogeniccases, remains unknown. In the present study, we analyzedFSH receptor gene for activating mutations in 29 womenwho experienced OHSS after ovarian stimulation for IVF. MATERIALS AND METHODSPatients All patients provided written informed consent for this study,which was approved by the ethics committee of Hospital dasClinicas in São Paulo, Brazil. Twenty-nine Brazilian womenwho experienced moderate-to-severe OHSS during ovarianstimulation were retrospectively recruited to participate inthis study. The patients were followed by the physicians(P.S. and E.M.) at the Huntington Centro de Medicina Re-produtiva and molecular analysis of the FSH receptor genewas carried out at the Hospital das Clinicas da Faculdade deMedicina da Universidade de São Paulo. Relevant clinical,hormonal, and sonographic data were collected retrospec-tively from patients’ medical records. A group of 50 Brazil-ian fertile women who were exposed to high endogenoushCG levels during pregnancy and did not develop OHSSserved as control for the molecular analysis of the FSHreceptor gene (8). The patients were classified according to previously es-tablished criteria in which moderate OHSS was character-ized by abdominal distension and discomfort, enlarged ova-ries of more than 5 cm, and ultrasonic evidence of ascites (9). Severe OHSS was defined by the findings of moderate syn-drome plus clinical evidence of ascites, hydrothorax, orrespiratory distress (9). Stimulation Protocol Patients were down-regulated by daily SC administration of GnRH analogues (Lupron; TAP Pharmaceutics ProductsInc., North Chicago, IL) commencing in the preceding treat-ment cycle luteal phase or GnRH antagonist cetrorelix (Ce-trotide; Serono, São Paulo, Brazil) in a daily dosage of 0.25mg SC administered in the mid-late follicular phase.Exogenous recombinant FSH (Gonal F; Serono, Bari,Italy) was administered in daily doses varying from 37.5 to225 IU/d alone or in combination with urinary LH and FSH(Menopur; Ferring, São Paulo, Brazil). Repeated serum E 2 concentrations and sonographic measurements of ovarianfollicle growth were carefully monitored and the dose of exogenous FSH was adjusted according to the patient’sindividual response. Ovulation was triggered by the admin-istration of 10,000 IU of hCG (Pregnyl; NV Organon, Neth-erlands) when at least two follicles attained 18–20 mm indiameter and oocyte retrieval was performed 24–36 hourslater by transvaginal guided-ultrasound follicle aspirationunder mild sedation and analgesia. Luteal support was pro-vided with progesterone (Crinone 8%; Serono, Sao Paulo,Brazil or Utrogestan; Besins International, Montrouge,France) initiated after oocyte aspiration and extended untilthe 8th week of pregnancy or until the initiation of menses. DNA Analysis Genomic DNA was extracted from peripheral blood leuko-cytes from all patients. Based on the high incidence of activating mutations in the transmembrane domain of G-protein-coupled receptors (4–6), as well as in the previous in vitro analysis of the FSH receptor gene (10), we selectedexons 4, 7, 9, and 10 for amplification followed by automaticsequencing.These exons were amplified by polymerase chain reaction(PCR) using four specific intronic oligonucleotide primerpairs (Table 1) designed according to reference sequenceNCBI GenBank accession number NM000145. The PCRwas performed in a 100-  L reaction mixture containing 200ng of genomic DNA, 10   L 10   reaction buffer, 1.5 mMMgCl 2 , 200   M each dNTP, 0.5 U  Taq  polymerase (Phar-macia, Piscataway, NJ), and 30 pmol of each primer. Afterinitial denaturation of 2 minutes at 94°C, samples weresubjected to 35 cycles of 1 minute at 94°C, 1 minute atvariable annealing temperature (Table 1), and 2 minutes at 72°C, followed by a final extension step of 10 minutes at72°C. The PCR products were purified with shrimp alkalinephosphatase and exonuclease I (PCR product presequencingkit; Amersham Life Sciences Inc., Cleveland, OH) beforesequencing using the ABI PRISM BigDye Terminator kit(Perkin-Elmer Applied Biosystems, Foster City, CA). Theproducts were directly sequenced using an ABI PRISM 310Genetic Analyzer automatic DNA sequencer (Perkin-Elmer).Two additional inner primers were used for sequencing of exon 10 (Table 1). Statistical Analysis The chronological age, basal FSH and LH levels, total FSHand LH dose, E 2  levels on the day before hCG administra-tion, and maximum ovarian diameter attained during treat-ment of patients with moderate and severe OHSS werecompared by Student’s  t  -test. The observed allelic variantfrequency of patients and controls were compared by the    2 test. Standard contingency tables were used to calculate oddsratio (OR) and    2 analysis was performed to generate  P values. The data are expressed as mean    SD. A  P  value  .05 was considered statistically significant. RESULTS The clinical, hormonal, and ultrasound data from patientswith OHSS are shown in Table 2. The age of these women 1696  d’Alva et al.  FSH receptor in ovarian hyperstimulation  Vol. 83, No. 6, June 2005  ranged from 18 to 40 years. From the 29 couples whoreceived assisted conception treatments, 10 suffered frommultiple infertility factors, 9 had male factor infertility, 2women suffered from polycystic ovarian syndrome (POS), 2had tubal disease, 1 endometriosis, 1 idiopathic infertility, 1ovarian LH resistance syndrome, and 3 women were ovumdonors. Of the 16 women who developed the severe form of OHSS, 11 required paracentesis (volume aspirated rangedfrom 1,500 to 6,200 mL) for the alleviation of symptoms.One patient also had pleural effusion. The remaining 13patients had a moderate form of the syndrome.No statistically significant difference was found in chro-nological age, basal LH and FSH levels, FSH doses, E 2 levels on the day before hCG administration, or ovarian sizebetween patients with moderate and severe OHSS. The LHdoses and the onset of symptoms were significantly differentbetween the groups with severe and moderate OHSS (Table2).The direct sequencing of exons 4, 7, 9, and 10 of FSHreceptor gene revealed no activating mutations in all patientsstudied. TABLE 1 Primer sequence and annealing temperatures used for amplification and sequencing of FSHreceptor gene.Exon Forward and reverse primer Annealing temperatures 4 F: 5 =  CCATCAAGATCACTAGC 3 =  50°CR: 5 =  ATAGTGGGGGTACCAAACTACA 3 = 7 F: 5 =  GCCCTTGCTCAGTGCTTCCAAT 3 =  52°CR: 5 =  TGGCCTTGAAGAATAGTCAGG 3 = 9 F: 5 =  GCCTGCTAACCAAGAGCAGA 3 =  54°CR: 5 =  TTGGGGAAATGCCTGAGCAG3 = 10 F: 5 =  CTGGATCTGAGATGTTGATTCTA 3 =  60°CR: 5 =  GAGATATCTGAACAAAAGCAC 3 = 10 a R: 5 =  ACACTGGCAGCATGGCG 3 = F: 5 =  TTCACTGACTTCCTCTGCAT 3 = a Inner primers used for sequencing of exon 10. d’Alva. FSH receptor in ovarian hyperstimulation. Fertil Steril 2005. TABLE 2 Clinical, laboratory, and sonographic data of patients with moderate and severe OHSS.Moderate OHSS(n  13)Severe OHSS(n  16) Chronological age (y) 30.8  4.5 31  4.3Basal FSH levels (IU/L) 4.4  2.2 4.4  3.3Basal LH levels (IU/L) 7.5  5.5 5.3  3.6Duration of stimulation (d) 10.2  2 9.7  1Total FSH dose (IU) 2,000  711 1,730  400Total LH dose (IU) 1,171  505 (n  6) a 586  216 (n  7) a Onset of symptoms after hCG (d) 5.5  1.6 a 10.9  4.3 a Maximum R ovarian diameter (cm) 9.7  1.7 9.7  1.3Maximum L ovarian diameter (cm) 9.5  1.7 8.6  1.2Median and range of E 2  levels (pg/mL) 1 daybefore hCG administration3,230 (448–23,600) 2,271 (415–11,190) Note:  Results are expressed as mean  SD. E 2  levels are expressed in median and range. LH, FSH, and E 2  levels weremeasured by electrochemiluminescense. a P  .05. b P  .001. d’Alva. FSH receptor in ovarian hyperstimulation. Fertil Steril 2005. 1697 Fertility and Sterility   We found either a heterozygous or homozygous G  Apoint substitution at nucleotides 993 and 2113 in 23/29patients (79.3%), 44.8% in heterozygous and 34.5% in ho-mozygous state. These changes resulted in the substitution of alanine for threonine at codon 307 and serine for asparagineat codon 680 of FSH receptor molecule. Both polymorphicsites are within exon 10. Analysis of both sites displayed alinkage of Thr307 to Asn680 and of Ala307 to Ser680variants in all patients. These variants were previously char-acterized as polymorphisms (11). Seventy-nine percent of  patients and 86% of controls presented the allelic variant(Table 3). Comparison of polymorphism frequencies did notshow a statistically significant difference between OHSSsubjects and the control group ( P  .58). DISCUSSION Because of the seriousness of the iatrogenic complication of ovulation induction, identification of women at risk forOHSS before initiation of assisted conception treatmentswould be of great clinical benefit. Although several clinicalparameters have been postulated as ovarian response predic-tors, to date none has proven to be fully effective (2). Considering the crucial function of FSH and its receptor inovulation and reproduction, it has been speculated that subtlegenetic alterations in the FSH receptor could explain thedifferent individual susceptibilities for the development of OHSS. To date, three different activating mutations(Thr449Ile, Asp567Asn, Thr449Ala) have been reported inFSH receptor in women with spontaneous OHSS renderingthe receptor hypersensitive to hCG (4–6). Although the recognition and binding of specific hormones are functionsof the receptor ectodomain, the mutations in women withOHSS were unexpectedly located in the transmembrane do-main, which is mainly responsible for the activation of intracellular regulatory cascades (12).Key residues implicated in the specificity of hormonerecognition by the glycoprotein hormone receptor were iden-tified (10). Substituting two residues of FSH receptor by their LH/CG receptor counterparts caused a gain of sensi-tivity of FSH receptor toward hCG without significantlyaltering the sensitivity to FSH. These substitutions,Lys104Asn and Lys179Gly, fall within the leucine-rich re-peat portion of FSH receptor ectodomain and are, respec-tively, codified by exons 4 and 7 of FSH receptor gene.In contrast to FSH receptor, several activating mutationshave been identified in the TSH receptor (13). In general,they tend to be concentrated in transmembrane helices andintervening loops, but two interesting exceptions areLys183Arg and mutations in Ser281 (13–16). By analogy with TSH receptor, exons 7 and 9 of the FSH receptor genewere also potential sites of activating mutations, as theyinclude the corresponding positions of these mutations.Based on this evidence, we studied the most frequent sitesof naturally activating mutations among glycoprotein recep-tors and specific regions implicated in specificity of hormo-ne–receptor interaction. However, we did not identify acti-vating mutations in the FSH receptor gene in 29 Brazilianwomen with moderate and severe iatrogenic OHSS, indicat-ing that the FSH receptor genotype does not play a role indetermining the risk of this syndrome in our series.Mayorga et al. (17) showed a correlation between the presence of two allelic variants of the FSH receptor inlinkage disequilibrium, Ala307Thr and Ser680Asn, andovarian responsiveness to FSH in 161 infertile women un-dergoing ovulation induction. Both the basal FSH levels andthe FSH dose required for successful stimulation were sig-nificantly smaller in the group homozygous for Asn680,indicating that FSH receptor genotype would be implicatedin the determination of the ovarian response to FSH (17). We also identified these FSH receptor polymorphisms in a sim-ilar frequency in the patients that experienced iatrogenicOHSS, as well as in normal fertile Brazilian women whowere exposed to high endogenous hCG levels during preg-nancy, indicating that these variants are not the cause of OHSS.In conclusion, the FSH receptor genotype did not play asignificant role in the risk of iatrogenic OHSS in this cohort.In spite of several years of clinical experience, the ovarianresponse to exogenous gonadotropin stimulation is still un-predictable.  Acknowledgments:  The authors acknowledge the assistance of HuntingtonCentro de Medicina Reprodutiva physicians, nurses and secretaries and thestaff of Laboratorio Hormonios e Genetica Molecular LIM42 for theirtechnical assistance. The authors are also grateful to Gustavo Serafini foreditorial aid and to Sonia Strong for English usage. REFERENCES 1. Delvigne A, Rozenberg S. Review of clinical course and treatment of ovarian hyperstimulation syndrome (OHSS). Hum Reprod Update2003;9:77–96.2. Delvigne A, Rozenberg S. Epidemiology and prevention of ovarianhyperstimulation syndrome (OHSS): a review. Hum Reprod Update2002;8:559–77.3. Elchalal U, Schenker J. The pathophysiology of ovarian hyperstimula-tion syndrome—views and ideas. Hum Reprod 1997;12:1129–37. TABLE 3 Distribution of FSH receptor polymorphismsin patient and control group. Ala/Ala %(n) Ala/Thr %(n)Thr/Thr %(n) Patients 20.7% (6) 44.8% (13) 34.5% (10)Controls 14% (7) 56% (28) 30% (15) Note:  Allele frequencies distribution among the threegenotype groups (  P  .58). d’Alva. FSH receptor in ovarian hyperstimulation. Fertil Steril 2005. 1698  d’Alva et al.  FSH receptor in ovarian hyperstimulation  Vol. 83, No. 6, June 2005  4. Smits G, Olatunbosug O, Delbaere A, Pierson R, Vassart G, CostagliolaS. Ovarian hyperstimulation syndrome due to a mutation in the follicle-stimulating hormone receptor. N Engl J Med 2003;349:760–6.5. Vasseur C, Rodien P, Beau I, Desroches A, Gérard C, Poncheville L, etal. A chorionic gonadotropin-sensitive mutation in the follicle-stimu-lating hormone receptor as a cause of familial gestational spontaneousovarian hyperstimulation syndrome. N Engl J Med 2003;349:753–9.6. Montanelli L, Delbaere A, Carlo C, Nappi C, Smits G, Vassart G, et al.A mutation in the follicle-stimulating hormone receptor as a cause of familial spontaneous ovarian hyperstimulation syndrome. J Clin Endo-crinol Metab 2004;89:1255–8.7. Ludwig M, Gembruch U, Bauer O, Diedrich K. Ovarian hyperstimu-lation syndrome (OHSS) in a spontaneous pregnancy with fetal andplacental triploidy: information about the general pathophysiology of OHSS. Hum Reprod 1998;13:2082–7.8. Kohek MBF, Batista MC, Russell AJ, Vass K, Giacaglia LR, MendoncaBB, et al. No evidence of the inactivating mutation (C566T) in thefollicle-stimulating hormone receptor gene in Brazilian women withpremature ovarian failure. Fertil Steril 1998;70:565–7.9. Golan A, Ron-El R, Herman A, Soffer Y, Weinraub Z, Caspi E.Ovarian hyperstimulation syndrome: an update review. Obstet GynecolSurv 1989;44:430–40.10. Smits G, Campillo M, Govaerts C, Janssens V, Richter C, Vassart G, etal. Glycoprotein hormone receptors: determinants in leucine-rich re-peats responsible for ligand specificity. EMBO J 2003;22:2692–703.11. Simoni M, Gromoll J, Höppner W, Kamischke A, Krafft T, Stähle D,et al. Mutational analysis of the follicle-stimulating hormone receptor innormal and infertile men: identification and characterization of twodiscrete FSHR isoforms. J Clin Endocrinol Metab 1999;84:751–5.12. Simoni M, Gromoll J, Nieschlag E. The follicle-stimulating hormonereceptor: biochemistry, molecular biology, physiology and pathophys-iology. Endocr Rev 1997;18:739–73.13. Farid NR, Kascur V, Balaz C. The human thyrotropin receptor is highlymutable: a review of gain-of-function mutations. Eur J Endocrinol2000;143:25–30.14. Rodien P, Bremont C, Raffin SML, Parma J, Van Sande J, CostagliolaS, et al. Familial gestational hyperthyroidism caused by a mutantthyrotropin receptor hypersensitive to human chorionic gonadotropin.N Engl J Med 1998;339:1823–6.15. Kopp P, van Sande J, Parma J, Duprez l, Gerber H, Joss E, et al.Congenital hyperthyroidism caused by a mutation in the thyrotropinreceptor gene. N Engl J Med 1995;332:150–4.16. Gruters A, Schonberg T, Biebermann H, Krude H, Kron HP, Dralle H,et al. Severe congenital hyperthyroidism caused by a germ line neomutation in the extracellular portion of the thyrotropin receptor. J ClinEndocrinol Metab 1998;83:1431–6.17. Mayorga M, Gromoll J, Behre HM, Gassner C, Nieschlag E, Simoni M.Ovarian response to follicle-stimulating hormone (FSH) stimulationdepends on the FSH receptor genotype. J Clin Endocrinol Metab2000;85:3365–9. 1699 Fertility and Sterility 
Search
Similar documents
View more...
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks