Career

Association of Genetic Polymorphisms of Glutathione-S-Transferase Genes ( GSTT1 , GSTM1 , and GSTP1 ) and Susceptibility to Nonalcoholic Fatty Liver Disease in Zahedan, Southeast Iran

Description
Association of Genetic Polymorphisms of Glutathione-S-Transferase Genes ( GSTT1 , GSTM1 , and GSTP1 ) and Susceptibility to Nonalcoholic Fatty Liver Disease in Zahedan, Southeast Iran
Categories
Published
of 6
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Related Documents
Share
Transcript
  ORIGINAL RESEARCH ARTICLES Association of Genetic Polymorphismsof Glutathione-S-Transferase Genes ( GSTT1 ,  GSTM1 ,and  GSTP1 ) and Susceptibility to NonalcoholicFatty Liver Disease in Zahedan, Southeast Iran Mohammad Hashemi, 1,2 Ebrahim Eskandari-Nasab, 2 Aliakbar Fazaeli, 2 Ali Bahari, 3 Noor-Allah Hashemzehi, 4 Sara Shafieipour, 5 Mohsen Taheri, 1 Abdolkarim Moazeni-Roodi, 6 Zahra Zakeri, 4 Alireza Bakhshipour, 4 and Saeid Ghavami 7 Oxidative damage is thought to play a pivotal role in the pathogenesis of nonalcoholic fatty liver disease(NAFLD). Glutathione-S-transferases (GSTs) are involved in cell protection against oxidative stress. We exam-ined whether  GSTM1 ,  GSTT1 , and  GSTP1  polymorphisms are associated with NAFLD in a sample of the Iranianpopulation. The current case–control study included 83 patients with NAFLD and 93 healthy subjects. The GSTM1  and  GSTT1  polymorphisms were analyzed by multiplex polymerase chain reaction (PCR). The  GSTP1 polymorphism was detected by tetra amplification refractory mutation system-PCR assay. The  GSTM1 -nullgenotype was significantly associated with the development of NAFLD (odds ratios [OR] = 2.171, 95% confi-dence intervals [CI] = 1.188–3.970,  p = 0.015). The  GSTP1  Val allele was shown to be a risk factor for NAFLD(OR = 1.739, 95% CI = 1.089–2.777,  p = 0.024). The  GSTT1  polymorphism was not significantly different betweencontrol and patient groups (  p = 0.221). This study showed that  GSTM1  and  GSTP1 , but not  GSTT1 , geneticpolymorphisms are associated with NAFLD in a sample of the Iranian population, and may be used to deter-mine the risk of development of NAFLD. Introduction N onalcoholic fatty liver disease  (NAFLD) is awidespread hepatic disorder characterized by accu-mulation of fat in the liver. Most symptoms in patients withNAFLD are similar to those with alcoholic fatty liver disease,and their progression can lead to liver cell necrosis, fibrosis,and cirrhosis of the liver (Song  et al. , 2005; Okanoue  et al. ,2011).There is a growing line of evidence that polymorphisms ingenes encoding enzymes responsible for xenobiotic metab-olism are among the key players in determining inter-individual susceptibility to liver-related diseases (Burim et al. , 2004; Ghobadloo  et al. , 2004; Palli  et al. , 2005; AbdEl-Moneim  et al. , 2008; Kandemir  et al. , 2008; Kiran  et al. , 2008;Kordi-Tamandani  et al. , 2011). Glutathione-S-transferases(GSTs) are a family of enzymes broadly expressed in mam-malian tissues, and have been demonstrated to be critical inthe conjugation reaction in phase II xenobiotics metabolismand catalyze reactions between glutathione and a variety of potentially toxic and carcinogenic electrophilic compounds(To-Figueras  et al. , 1997; Singh  et al. , 2008; Mo  et al. , 2009).Based on their primary structure, the distinct cytosolic iso-enzymes have been assorted to separate classes that are co-ded into at least eight diverse loci:  m  ( GSTM ),  y  ( GSTT  )  p ( GSTP ),  s  ( GSTS ),  a  ( GSTA ),  k  ( GSTK  ), o ( GST  O), and  t  ( GSTZ )(To-Figueras  et al. , 1997; Mo  et al. , 2009).  GSTT1 ,  GSTM1 , and GSTP1  are mapped on chromosomes 1p13.3, 22q11.2, and11q13, respectively, and have gained the most attention (Mo et al. , 2009). Homozygous deletion of   GSTM1  and  GSTT1 genes is the result of homologous recombination of a numberof repeats spanning the left and right of these genes. Thesedeletions, referred to as  GSTM1  null and  GSTT1  null, resultin the lack of enzyme activity. The  GSTP1  polymorphism is 1 Cellular and Molecular Research Center and  2 Department of Clinical Biochemistry, School of Medicine, Zahedan University of MedicalSciences, Zahedan, Iran. 3 Department of Internal Medicine, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran. 4 Department of Internal Medicine, School of Medicine, Zahedan University of Medical Sciences, Zahedan, Iran. 5 Department of Internal Medicine, School of Medicine, Kerman University of Medical Sciences, Kerman, Iran. 6 Research Center for Infectious diseases and Tropical Medicine, Zahedan University of Medical Sciences, Zahedan, Iran. 7 Department of Physiology, Manitoba Institute of Child Health, University of Manitoba, Winnipeg, Manitoba, Canada. DNA AND CELL BIOLOGYVolume 31, Number 5, 2012 ª  Mary Ann Liebert, Inc.Pp. 672–677DOI: 10.1089/dna.2011.1343 672  the result of a base substitution (A to G), which leads to anamino acid replacement (codon 105, isoleucine to valine) inthe GSTP1 binding site and modifies enzyme catalytic ac-tivity (Hur  et al. , 2005).A limited number of studies have evaluated the associa-tion of   GST   genotype profile with liver-related diseases.Several have reported a positive association between the GSTM1  and  GSTT1  null genotypes and  GSTP1 -Val (105)polymorphisms and increased risk of alcoholic pancreatitis,alcoholic cirrhosis, hepatocellular carcinoma, hepatis B virus(HBV) infection progression, NAFLD, and cryptogenic cir-rhosis development (Frenzer  et al. , 2002; Burim  et al. , 2004;Ghobadloo  et al. , 2004; Mohammadzadeh Ghobadloo  et al. ,2006; Abd El-Moneim  et al. , 2008; Hori  et al. , 2009; Khan  et al. ,2009; Maruyama  et al. , 2010). The current study was carriedout to determine the impact of   GSTM1 ,  GSTT1 , and  GSTP1 genetic polymorphisms on the susceptibility of NAFLD. Materials and Methods Eighty-three patients with NAFLD and 93 healthy indi-viduals were recruited for this study. The local EthicsCommittee of Zahedan University of Medical Sciences ap-proved this study, and informed consent was obtained fromall participants. The study design and the enrolment proce-dure have been previously described in detail (Hashemi et al. , 2011). Genomic DNA were extracted from peripheral blood as previously described (Hashemi  et al. , 2010a).Tetra primer amplification refractory mutation system–polymerase chain reaction (T-ARMS-PCR) is a simple and ra-pid method for detection of single-nucleotide polymorphism(Ye  et al. , 2001; Hashemi  et al. , 2010b, 2011). We designed T-ARMS-PCR for detecting the  GSTP1  exon 5, 105 Ile/Val(rs1695) polymorphisms. We used two external primers (For-ward outer: 5 ¢  CAGGTGTCAGGTGAGCTCTGAGCACC 3 ¢ ,Reverse outer: 5 ¢  ATAAGGGTGCAGGTTGTGTCTTGTCCCA3 ¢ ), and the two internal primers were (Forward inner (A alleleor Ile allele): 5 ¢  CGTGGAGGACCTCCGCTGCAAATCCA3 ¢ , Reverse inner (G allele or Val allele): 5 ¢ -GCTCACATAGTTGGTGTAGATGAGGGATAC-3 ¢ ). Product sizes were233bp for A allele and 290bp for G allele, whereas the productsize of the two outer primers was 467bp, as schematicallyshown in Figure 1.PCR was performed by using commercially available PCRpremix (AccuPower PCR PreMix; BIONEER, Daejeon, Kor-ea) according to the manufacturer’s instructions. Briefly, 1 m Ltemplate DNA ( * 100ng/ m L), 1 m L of each primer (10pmol/ m L), and 15 m L DNase-free water were added to AccuPowerPCR PreMix. Amplification was performed with an initialdenaturation step at 95  C for 5min, followed by 25 cycles at95  C for 30s, 65  C for 20s, and 72  C for 15s with a finalextension at 72  C for 10min. The PCR products were sepa-rated by electrophoresis in 2% agarose gels, and visualized by ethidium bromide staining. The T-ARMS-PCR methodswere effectively applied to the genotyping polymorphism of  GSTP1  105 Ile/Val (rs1695). The genotypes determined bythis method (Fig. 2) were concordant with those determined by sequencing (Supplementary Fig. S1; Supplementary Dataare available online at www.liebertonline.com/dna).MultiplexPCRwasusedtosimultaneouslydetectthe GSTT1 and  GSTM1  genes polymorphism in the presence of the inter-nal control. Primers for the  GSTM1  polymorphism were asfollows: forward 5 ¢  GCTGCCCTACTTGATTGATG 3 ¢  and re-verse 5 ¢  CCCCAAATCCAAACTCTGTC 3 ¢ . Primers for  GSTT1 were as follows: forward: 5 ¢  TTCTGCTTTATGGTGGGGTC 3 ¢ and reverse 5 ¢  GTGATGTTCCCTGTTTTCCT 3 ¢ . Toll-like re-ceptor 2 ( TLR2 ) primers were as follows: forward 5 ¢  GATGCATTTGTTTCTTACAGTGAGCG 3 ¢  and reverse 5 ¢  TCTCATCAAAAAGACGGAAATGGG3 ¢ , and were used asaninternalcontrol.PCR was performed as described above with amplification by denaturation at 95  C (5min), followed by 25 cycles of 95  C for 30s, 60  C for 25s, and 72  C for 30s, with a finalextension step of 72  C for 10min. The PCR products wereelectrophoresed in 2% agarose gels, and visualized by ethi-dium bromide staining (Fig. 3).DNA from samples positive for  GSTM1  and  GSTT1  ge-notypes yielded bands of 325 and 542bp, respectively,whereas the internal positive control ( TLR2 ) PCR productcorresponded to 259bp. Absence of 325 and 542bp bandsindicated homozygous null genotypes of   GSTM1  and GSTT1 , respectively. To ensure genotyping quality, we re-genotyped all polymorphisms in random samples and foundno genotyping mistake. FIG. 1.  Schematic illustration of tetra amplification refrac-tory mutation system–polymerase chain reaction (PCR) as-say for detection of glutathione-S-transferase P1 ( GSTP1) Ile105Val (rs1695 A/G). Two forward and two reverse spe-cific primers are used to produce three potential products.Product sizes were 233bp for A allele, 290bp for G allele,and 467bp for two outer primers (control band). FIG. 2.  Photograph of the PCR products of the ( GSTP1 )Ile105Val (rs1695 A/G) gene polymorphism. M, DNAmarker. ASSOCIATION OF  GSTS  GENES POLYMORPHISMS AND NAFLD 673  The association among the  GSTM1 ,  GSTT1 , and  GSTP1 genotypes and the risk of NAFLD was estimated by usingodds ratios (OR) with 95% confidence intervals (CI). Allcomputational analyses were executed by using statisticalsoftware package SPSS 18. Results Eighty-three NAFLD (50 men and 33 women; age40.45 – 12.12) and 93 normal subjects (42 men and 51 wom-en; age 42.33 – 16.25) were in the current study. Age andsex were not significantly different between the groups (  p > 0.05).  GSTM1 ,  GSTT1 , and  GSTP1  genotype distributionwere compared between NAFLD and healthy individuals inTable 1. The frequency of the  GSTM1  null genotype wassignificantly higher in NAFLD (57.8%) than in the controlgroup (38.7%) and is a risk factor for susceptibility toNAFLD (OR = 2.171, 95% CI = 1.188–3.970,  p = 0.015). Nosignificant differences were detected between the NAFLDgroup (2.4%) and the control group (0%) for the  GSTT1  nullmutation, but a significant difference was observed betweencontrols and patients with regard to the  GSTP1  105Ile/Valpolymorphism (  p = 0.012). We found that the Val allele is arisk factor for susceptibility to NAFLD (OR = 1.739, 95%CI = 1.089–2.777, and  p = 0.024). Based on our findings, sam-ple power was calculated for  GSTT  1,  GSTM1 , and  GSTP1  bycomparison of each genotype with the sum of other relatedgenotypes at each polymorphic region by using STATA 10and are shown in Table 1.In addition, the combination of   GSTM1 ,  GSTT1 , and GSTP1  genotypes was analyzed (Table 2). A synergisticgene–gene interaction was found in the  GSTM1  Null/ GSTP1 Ile/Val or Val/Val genotypes (OR = 5.21, 95% CI = 2.14–12.69,  p < 0.001). Discussion In the current study, we examined the association betweenNAFLD and polymorphisms of   GSTM1 ,  GSTT1 , and  GSTP1 in a sample of the Iranian population. We found no signifi-cant difference between NAFLD and healthy individualswith regard to the  GSTT1  null genotype. However, the GSTM1  null genotype was significantly more frequent inNAFLD than control subjects, and the  GSTP1  Ile 105 allelewas shown to be a risk factor for susceptibility to NAFLD inthis sample of the Iranian population. This corresponds withthe findings of  Hori  et al.  (2009), who also described in-creased frequency of the  GSTM1  null genotype in patientswith NAFLD compared with healthy individuals. However,they did not observe a statistically significant difference in GSTP1  105 Ile/Val and  GSTT1  null polymorphisms (Hori et al. , 2009). Recently, it has been reported that there was noassociation between promoter methylation and expressionof   GSTT1  and  GSTP1  genes and risk of NAFLD (Kordi-Tamandani  et al. , 2011).Given the functional significance of GSTs in cellular pro-tection from environmental and oxidative stress, geneticvariations among individuals that alter enzyme activity are FIG. 3.  Representative multiplex PCR products resolved byagarose gel electrophoresis to detect the presence or absenceof the  GSTT1  and  GSTM1  genes simultaneously in the sametube in the presence of an internal control.  GSTT1 ; 542bp, GSTM1 ; 325bp, Toll-like receptor 2; 259bp (control). M,DNA marker. Lane 1:  GSTT1  present  GSTM1  null genotype;lane 2: both  GSTT1  and  GSTM1  present null genotype; lane3: both  GSTT1  and  GSTM1  present genotype. Table  1.  Frequency Distribution of the  GSTM1 ,  GSTT1 , and  GSTP1  Genotypesin Subjects with and without Nonalcoholic Fatty Liver Disease GST genotype NAFLD  n  (%) Control  n  (%) OR (95% CI)  p -Value Study power (%)GSTM1 Present 35 (42.2) 57 (61.3) 2.17 (1.19–3.97) 0.015 66Null 48 (57.8) 36 (38.7) GSTT1 Present 81 (97.6) 93 (100) 5.7 (0.27–12.3) 0.221 13Null 2 (2.4) 0 (0) GSTP1 Ile/Ile 29 (35.0) 53 (57.0) Ref. 79Ile/Val 51 (61.4) 37 (39.8) 2.52 (1.35–4.68) 0.003 78Val/Val 3 (3.6) 3 (3.2) 1.83 (0.35–9.65) 0.633 7 GSTP1  allelesIle allele 109 (65.7) 143 (76.9) 1.74 (1.09–2.78) 0.024 60Val allele 57 (34.3) 43 (23.1) NAFLD, nonalcoholic fatty liver disease; GST, glutathione-S-transferase; OR, odds ratios; CI, confidence intervals. 674 HASHEMI ET AL.  one of the main factors leading to failure in the criticalfunctions of the liver. The oxidative metabolism of xenobi-otics is carried out largely by cytochrome P450 and GSTenzymes, in which the latter is present in the cytosol, mito-chondria, and microsomal membrane of almost all tissuesthroughout the body (Wang  et al. , 2000; Hardwick  et al. ,2010). GSTs play an important role in the detoxification of exogenous as well as endogenous compounds such as toxicproducts of lipid oxidation (Laborde, 2010). The liver plays avital role in regulating fatty-acid and triglyceride metabolism by synthesizing, storing, releasing, and oxidizing free fattyacids (FFA). Disruption of triacylglycerol release, synthesis,or oxidation pathways could contribute to its accumulationin the liver (Utzschneider and Kahn, 2006). Nonalcoholicfatty NAFLD is the most common reason for abnormal liverfunction, and may occur in 10%–30% of the population (Hori et al. , 2009). Complications associated with NAFLD includehepatocyte accumulation of triglycerides, chronic oxidativestress levels, insulin resistance (IR), inflammation, and fi- brosis (Hardwick  et al. , 2010). NAFLD can progress fromsimple steatosis to nonalcoholic steatohepatitis, hepatocytenecrosis, fibrosis, and cirrhosis of the liver (Song  et al. , 2005).This progression is thought to be the consequence of twophysiologic incidents: IR and oxidative stress (Charlton,2004). In IR states, the amount of FFA accessible for oxida-tion surpasses the mitochondrial capacity, which results inincreased lipid peroxidation. Excess acetyl CoA enters thecitric acid cycle, thereby augmenting NADH (nicotinamidedinucleotide phosphate) production and delivery of elec-trons to the respiratory chain. This process could lead tomitochondrial failure leading to increased production of re-active oxygen species (ROS) (Schreuder  et al. , 2008; Hori et al. , 2009). Elevated ROS results in hepatocellular injury byseveral mechanisms, including inactivation of membranesodium channels, oxidative protein modifications, inductionof lipid peroxidation, and cytokine production (Eaton andBammler, 1999; Petlevski  et al. , 2003).Lipid peroxides formed due to oxidative stress serve asendogenous substrates for GSTs. The GSTs are phase IImetabolic enzymes and play a critical role in the defenseagainst oxidative stress products and a variety of electro-philic compounds. In the human liver, hepatocytes containhigh levels of GSTM and GSTT, whereas GSTP is predomi-nantly expressed in the bile ducts (Eaton and Bammler, 1999;Lakehal  et al. , 1999).The  GSTM1  and  GSTT1  null genotypes are associated withdeficiencies in GSTM1 and GSTT1 enzyme activity (Seide-gard  et al. , 1988; Bolt and Thier, 2006), and the  GSTP1 Ile105Val polymorphism is associated with altered catalyticfunction (Watson  et al. , 1998; Cote  et al. , 2009). Individualswith  GSTM1  and  GSTT1  null genotypes or  GSTP1  105Valallele would be expected to have decreased GST detoxifi-cation and, thus, potential increases in the levels of toxicmetabolites.In conclusion, our findings suggest that a deletion of the GSTM1  gene and functional polymorphism le105Val of the GSTP1  gene may contribute to vulnerability to NAFLD in asample of Iranian subjects. One limitation of this study is thelow sample size. Further research in larger samples is neededto confirm these findings. Acknowledgments This work was supported by a research grant from Za-hedan University of Medical Sciences. The authors thank allsubjects who willingly participated in the study. S.G. wassupported by a Parker B. Francis Fellowship in respiratorydisease. Disclosure Statement No competing financial interests exist. References Abd El-Moneim, E., Younis, F.A., Allam, N., Gameel, K., andOsman, M. (2008). Gene deletion of glutathione S-transferaseM1 and T1 and risk factors of hepatocellular carcinoma inEgyptian patients. Egypt J Immunol  15,  125–134.Bolt, H.M., and Thier, R. (2006). Relevance of the deletionpolymorphisms of the glutathione S-transferases GSTT1 andGSTM1 in pharmacology and toxicology. Curr Drug Metab  7, 613–628.Burim, R.V., Canalle, R., Martinelli Ade, L., and Takahashi, C.S.(2004). Polymorphisms in glutathione S-transferases GSTM1,GSTT1 and GSTP1 and cytochromes P450 CYP2E1 andCYP1A1 and susceptibility to cirrhosis or pancreatitis in al-coholics. Mutagenesis  19,  291–298. Table  2.  Frequency Distribution of the Combination of  GST    Genotypesand Association with Nonalcoholic Fatty Liver Disease GST genotype NAFLD  n  (%) Control  n  (%) OR (95% CI)  p -ValueGSTM1 present/ GSTT1  present 35 (42.2) 57 (61.3) Ref. — GSTM1 present/ GSTT1  Null 46 (55.4) 36 (38.7) 2.11 (1.14–3.82) 0.018 GSTM1 Null/ GSTT1  Null 2 (2.4) 0 (0.0) — — GSTM1Null/GSTT1  present 0 (0.0) 0 (0.0) — — GSTM1 present  /GSTP1  Ile/Ile 15 (18.1) 29 (31.2) Ref. — GSTM1 present  /GSTP1  Ile/Val or Val/Val 19 (22.9) 27 (29.0) 1.36 (0.58–3.23) 0.520 GSTM1 Null/ GSTP1  Ile/Ile 14 (16.9) 24 (25.8) 1.13 (0.45–2.79) 0.820 GSTM1 Null/ GSTP1  Ile/Val or Val/Val 35 (42.2) 13 (14.0) 5.21 (2.14–12.69)  < 0.001 GSTT1 present/ GSTP1  Ile/Ile 27 (32.5) 53 (57.0) Ref. — GSTT1 present/ GSTP1  Ile/Val or Val/Val 54 (65.1) 40 (43.0) 2.65 (1.43–4.92) 0.002 GSTT1Null/GSTP1 Ile/Ile  2 (2.4) 0 (0.0) — — GSTT1Null/GSTP1 Ile/Val or Val/Val  0 (0.0) 0 (0.0) — — ASSOCIATION OF  GSTS  GENES POLYMORPHISMS AND NAFLD 675  Charlton, M. (2004). Nonalcoholic fatty liver disease: a review of current understanding and future impact. Clin GastroenterolHepatol  2,  1048–1058.Cote, M.L., Chen, W., Smith, D.W., Benhamou, S., Bouchardy,C., Butkiewicz, D., Fong, K.M., Gene, M., Hirvonen, A.,Kiyohara, C., Larsen, J.E., Lin, P., Raaschou-Nielsen, O., Po-vey, A.C., Reszka, E., Risch, A., Schneider, J., Schwartz, A.G.,Sorensen, M., To-Figueras, J., Tokudome, S., Pu, Y., Yang, P.,Wenzlaff, A.S., Wikman, H., and Taioli, E. (2009). Meta- andpooled analysis of GSTP1 polymorphism and lung cancer: aHuGE-GSEC review. Am J Epidemiol  169,  802–814.Eaton, D.L., and Bammler, T.K. (1999). Concise review of theglutathione S-transferases and their significance to toxicology.Toxicol Sci  49,  156–164.Frenzer, A., Butler, W.J., Norton, I.D., Wilson, J.S., Apte, M.V.,Pirola, R.C., Ryan, P., and Roberts-Thomson, I.C. (2002).Polymorphism in alcohol-metabolizing enzymes, glutathioneS-transferases and apolipoprotein E and susceptibility to al-cohol-induced cirrhosis and chronic pancreatitis. J Gastro-enterol Hepatol  17,  177–182.Ghobadloo, S.M., Yaghmaei, B., Bakayev, V., Goudarzi, H.,Noorinayer, B., Rad, F.H., Samiy, S., Aghabozorghi, S., andZali, M.R. (2004). GSTP1, GSTM1, and GSTT1 genetic poly-morphisms in patients with cryptogenic liver cirrhosis. JGastrointest Surg  8,  423–427.Hardwick, R.N., Fisher, C.D., Canet, M.J., Lake, A.D., andCherrington, N.J. (2010). Diversity in antioxidant responseenzymes in progressive stages of human nonalcoholic fattyliver disease. Drug Metab Dispos  38,  2293–2301.Hashemi, M., Hoseini, H., Yaghmaei, P., Moazeni-Roodi, A., Ba-hari, A., Hashemzehi, N., and Shafieipour, S. (2011). Associa-tion of polymorphisms in glutamate-cysteine ligase catalyticsubunit andmicrosomaltriglyceride transfer proteingenes withnonalcoholic Fatty liver disease. DNA Cell Biol  30,  569–575.Hashemi, M., Moazeni-Roodi, A.K., Fazaeli, A., Sandoughi, M.,Bardestani, G.R., Kordi-Tamandani, D.M., and Ghavami, S.(2010a). Lack of association between paraoxonase-1 Q192Rpolymorphism and rheumatoid arthritis in southeast Iran.Genet Mol Res  9,  333–339.Hashemi, M., Moazeni-Roodi, A.K., Fazaeli, A., Sandoughi, M.,Taheri, M., Bardestani, G.R., Zakeri, Z., Kordi-Tamandani,D.M., and Ghavami, S. (2010b). The L55M polymorphism of paraoxonase-1 is a risk factor for rheumatoid arthritis. GenetMol Res  9,  1735–1741.Hori, M., Oniki, K., Nakagawa, T., Takata, K., Mihara, S., Mar-ubayashi, T., and Nakagawa, K. (2009). Association betweencombinations of glutathione-S-transferase M1, T1 and P1 ge-notypes and non-alcoholic fatty liver disease. Liver Int  29, 164–168.Hur, S.E., Lee, J.Y., Moon, H.S., and Chung, H.W. (2005). Poly-morphisms of the genes encoding the GSTM1, GSTT1 andGSTP1 in Korean women: no association with endometriosis.Mol Hum Reprod  11,  15–19.Kandemir, O., Tamer, L., and Tasdelen, B. (2008). Effects of GSTT1, GSTM1 and GSTP1 gene polymorphism on the courseof hepatitis B virus infection. Hepatogastroenterology  55, 1729–1733.Khan, A.J., Choudhuri, G., Husain, Q., and Parmar, D. (2009).Polymorphism in glutathione-S-transferases: a risk factor inalcoholic liver cirrhosis. Drug Alcohol Depend  101,  183–190.Kiran, M., Chawla, Y.K., and Kaur, J. (2008). Glutathione-S-transferase and microsomal epoxide hydrolase polymorphismand viral-related hepatocellular carcinoma risk in India. DNACell Biol  27,  687–694.Kordi-Tamandani, D.M., Hashemi, M., Birjandian, E., Bahari, A.,Valizadeh, J., and Torkamanzehi, A. (2011). Lack of associa-tion of GSTT1 and GSTP1 genes methylation and their ex-pression profiles with risk of NAFLD in a sample of Iranianpatients. Clin Res Hepatol Gastroenterol  35,  387–392.Laborde, E. (2010). Glutathione transferases as mediators of signaling pathways involved in cell proliferation and celldeath. Cell Death Differ  17,  1373–1380.Lakehal, F., Wendum, D., Barbu, V., Becquemont, L., Poupon,R., Balladur, P., Hannoun, L., Ballet, F., Beaune, P.H., andHousset, C. (1999). Phase I and phase II drug-metabolizingenzymes are expressed and heterogeneously distributed in the biliary epithelium. Hepatology  30,  1498–1506.Maruyama, K., Harada, S., Yokoyama, A., Mizukami, S., Nar-use, S., Hirota, M., Nishimori, I., and Otsuki, M. (2010). As-sociation analyses of genetic polymorphisms of GSTM1,GSTT1, NQO1, NAT2, LPL, PRSS1, PSTI, and CFTR withchronic alcoholic pancreatitis in Japan. Alcohol Clin Exp Res 34 Suppl 1,  S34–S38.Mo, Z., Gao, Y., Cao, Y., Gao, F., and Jian, L. (2009). An updatingmeta-analysisoftheGSTM1,GSTT1,andGSTP1polymorphismsand prostate cancer: a HuGE review. Prostate  69,  662–688.Mohammadzadeh Ghobadloo, S., Yaghmaei, B., Allameh, A.,Hassani, P., Noorinayer, B., and Zali, M.R. (2006). Poly-morphisms of glutathione S-transferase M1, T1, and P1 inpatients with HBV-related liver cirrhosis, chronic hepatitis,and normal carriers. Clin Biochem  39,  46–49.Okanoue, T., Umemura, A., Yasui, K., and Itoh, Y. (2011).Nonalcoholic fatty liver disease and nonalcoholic steatohepa-titis in Japan. J Gastroenterol Hepatol  26 Suppl 1,  153–162.Palli, D., Saieva, C., Gemma, S., Masala, G., Gomez-Miguel, M.J.,Luzzi, I., D’Errico, M., Matullo, G., Ozzola, G., Manetti, R.,Nesi, G., Sera, F., Zanna, I., Dogliotti, E., and Testai, E. (2005).GSTT1 and GSTM1 gene polymorphisms and gastric cancer ina high-risk italian population. Int J Cancer  115,  284–289.Petlevski, R., Hadzija, M., Slijepcevic, M., Juretic, D., and Petrik, J. (2003). Glutathione S-transferases and malondialdehyde inthe liver of NOD mice on short-term treatment with plantmixture extract P-9801091. Phytother Res  17,  311–314.Schreuder, T.C., Verwer, B.J., van Nieuwkerk, C.M., andMulder, C.J. (2008). Nonalcoholic fatty liver disease: an over-view of current insights in pathogenesis, diagnosis and treat-ment. World J Gastroenterol  14,  2474–2486.Seidegard, J., Vorachek, W.R., Pero, R.W., and Pearson, W.R.(1988). Hereditary differences in the expression of the humanglutathione transferase active on trans-stilbene oxide are dueto a gene deletion. Proc Natl Acad Sci U S A  85,  7293–7297.Singh, H., Sachan, R., Devi, S., Pandey, S.N., and Mittal, B.(2008). Association of GSTM1, GSTT1, and GSTM3 genepolymorphisms and susceptibility to cervical cancer in aNorth Indian population. Am J Obstet Gynecol  198,  303 e301–e306.Song, J., da Costa, K.A., Fischer, L.M., Kohlmeier, M., Kwock, L.,Wang, S., and Zeisel, S.H. (2005). Polymorphism of the PEMTgene and susceptibility to nonalcoholic fatty liver disease(NAFLD). FASEB J  19,  1266–1271.To-Figueras, J., Gene, M., Gomez-Catalan, J., Galan, M.C.,Fuentes, M., Ramon, J.M., Rodamilans, M., Huguet, E., andCorbella, J. (1997). Glutathione S-transferase M1 (GSTM1) andT1 (GSTT1) polymorphisms and lung cancer risk amongNorthwestern Mediterraneans. Carcinogenesis  18,  1529–1533.Utzschneider, K.M., and Kahn, S.E. (2006). Review: the role of insulin resistance in nonalcoholic fatty liver disease. J ClinEndocrinol Metab  91,  4753–4761. 676 HASHEMI ET AL.
Search
Similar documents
View more...
Tags
Related Search
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks